A Sensitive Method for Detecting <i>Beauveria bassiana</i>, an Insecticidal Biocontrol Agent, Population Dynamics, and Stability in Different Substrates

Gu, Zepei; Chen, Lijie; Zhang, Weixing; Su, Pin; Zhang, Deyong; Du, Xiaohua; Peng, Qianze; Liu, Zhuoxin; Liao, Xiaolan; Liu, Yong

doi:https://doi.org/10.1155/2023/9933783

Canadian Journal of Infectious Diseases and Medical Microbiology

On this page

Abstract Introduction Materials and Methods Results Conclusion and Discussion Abbreviations Data Availability Disclosure Conflicts of Interest Authors’ Contributions Acknowledgments Supplementary Materials References Copyright Related Articles

Research Article | Open Access

Volume 2023 | Article ID 9933783 | https://doi.org/10.1155/2023/9933783

A Sensitive Method for Detecting Beauveria bassiana, an Insecticidal Biocontrol Agent, Population Dynamics, and Stability in Different Substrates

Zepei Gu,^1,2Lijie Chen,^2,3Weixing Zhang,²Pin Su,^1,2,3Deyong Zhang,^1,2,3Xiaohua Du,^1,2Qianze Peng,²Zhuoxin Liu,^2,3Xiaolan Liao ,¹and Yong Liu^2,3

Academic Editor: Vinicius Castro

Received15 Feb 2023

Revised18 Jul 2023

Accepted01 Aug 2023

Published25 Aug 2023

Abstract

Beauveria bassiana is a well-known insecticidal biocontrol agent. Despite its broad field applications, its survival, colonization, and stability under field conditions remained unclear, mainly due to the lack of a quick and reliable detection method. In this study, we developed a quantitative real-time PCR technology to monitor the stability and population dynamics of B. bassiana in different substrates (water, soil, and on the cotton leaves surface), different spores of B. bassiana applied on Chinese cabbage leaves surface, and the lethality of Pieris rapae spraying with different spores of B. bassiana. Our results showed a decreased concentration of B. bassiana DNA in all three substrates from the 1^st day till 9^th day of post inoculation (dpi) period, possibly due to the death of B. bassiana. After this decrease, a quick and significant rebound of B. bassiana DNA concentration was observed, starting from the 11^th dpi in all three substrates. The B. bassiana DNA concentration reached the plateau at about 13^th dpi in water and 17^th dpi in the soil. On cotton leaves surface, the B. bassiana DNA concentration reached the highest level at the 17^th dpi followed by a small decline and then stabilized. This increase of DNA concentration suggested recovery of B. bassiana growth in all three substrates. We found that the most suitable killing effectiveness of P. rapae was the 1.0 × 10⁷ spores/mL of B. bassiana. In summary, we have established a detection technology that allows a fast and reliable monitoring for the concentration and stability of B. bassiana under different conditions. This technology can benefit and help us in the development of proper management strategies for the application of this biocontrol agent in the field.

1. Introduction

Beauveria bassiana is an entomopathogenic fungus that can infect more than 700 insect species belonging to 149 different families in 15 different orders by causing white muscardine disease in them [1–3]. To date, entomopathogenic fungi have been used as biological control agents for the management of various insect and mite pests [4]. B. bassiana is the most well studied entomopathogenic fungi and has been frequently used as a commercial mycoinsecticide in the field [5, 6]. For example, B. bassiana was used to control insect pests, including Pissodes castaneus, Ostrinia nubilalis, and Rhynchophorus ferrugineus, infield through direct spraying [7–9]. It is known that B. bassiana is safe to human, natural beneficial insects, and beneficial microorganisms. During field applications, it can also be used together with other commercial chemical pesticides [10–12]. More importantly, there is no evidence that insect pest(s) has evolved resistance against B. bassiana. Currently, B. bassiana is widely used to control insect pests in the order of Lepidoptera and Coleoptera, including many forest pests [13, 14].

It was reported that B. bassiana could secrete many biologically active compounds like lactide and poisonous proteases during its infection in insect hosts [15, 16]. B. bassiana is also known to hijack nutrients and water from the infected insects to accelerate their death process [17]. B. bassiana spores can be formulated to produce wettable powder for commercial use in agriculture as well as in forests [18–21]. A separate study conducted recently showed that the survival and successful recolonization of the B. bassiana in field depended largely on environmental factors [22]. We reasoned that the understanding of the survival and growth dynamics of this fungus in nature is necessary for the integration of this biocontrol agent into a more effective and safe plant protection strategy and to reduces public concerns on environment conservation [23, 24].

Peng and coworkers investigated the growth and survival of Metarhizium anisopliae in oriental migratory locust [25]. In this study, we used a similar strategy to establish an accurate quantitative real-time PCR technology to determine the stability of B. bassiana in various substrates (i.e., water, soil, and cotton leaves surface) at 28°C. With this new technology, we can now monitor B. bassiana population dynamics and regrowth in field samples and develop more effective management strategies using this and other biocontrol agents.

2. Materials and Methods

2.1. Materials

B. bassiana was originally isolated from a tomato field in Yueyang, China (113°00′4.39″E, 29°45′9.41″N) and then maintained in the laboratory. Before use, this fungus was grown till a concentration of 1.0 × 10¹² spores/g·mass. The liquid growth medium used for B. bassiana was potato dextrose agar (PDA-Medium), and the carbon-to-nitrogen (C : N) ratio was at 10 : 1 (Vega. 2003). Cotton plants used in this study were grown in a greenhouse and the soil was from Chunhua in Changsha, China (113°25′56.50″E, 28°27′80.40″N), which contained 10% water, and the water used was the natural water from a lake in Changsha, China (113°09′04.77″E, 28°19′39.14″N).

2.2. DNA Extraction from B. bassiana

DNA was extracted from B. bassiana containing water, soil, and plant leaf samples using a DNA extraction kit (Tiangen Biochemical Technology, Beijing, China). Concentration and quality of each DNA sample were measured by using a spectrophotometer (Thermo Fisher Scientific, Massachusetts, USA). For each DNA sample, three technical replicates were analyzed during real-time fluorescent PCR with a SYBR Green I reagent (TransGen Biotech, Beijing, China) as instructed by the manufacturer (TransGen Biotech).

2.3. Synthesis of B. bassiana Specific Primers

The initial PCR amplification was carried out using a set of bacterial universal primers (Baker. 2003) and the DNA isolated from B. bassiana. The resulting PCR products were cloned and sequenced by the TSINGKN Biotech (TSINGKN Biotech, Beijing, China). Conserved DNA sequences obtained from the PCR products were analyzed using the DNAMAN software, and six pairs of real-time PCR primers were designed based on the obtained sequences using the Primer 5.0 software in the DNAMAN (LynnonBiosoft, USA). In the subsequent real-time PCR assays, diluted B. bassiana genomic DNA or double distilled water (ddH₂O) were used as the positive and negative control sample, respectively. The six designed primer sets were first tested by gradient PCR with three different annealing temperatures (52, 54 and 56°C) and later by PCR amplifications. The resulting PCR products were visualized in agarose gels through electrophoresis. The primer set giving a single specific PCR product was considered to be the optimal B. bassianareal-time PCR primer set and was used in further experiments.

2.4. Preparation of Real-Time PCR Standard Curve

According to a previously described method [26], we first generated a recombinant plasmid DNA carrying a fragment of B. bassiana genomic DNA and then measured its concentration using a spectrophotometer. The copy number of the recombinant plasmid DNA was calculated as previously reported [27] and then further diluted prior to the real-time fluorescent PCR on a CFX96™Real-Time System (Bio-Rad, California, USA), and the standard curve was established using the concentration logarithm and the Ct values.

2.5. Determination of Detection Limit Using Purified B. bassiana DNA

B. bassiana was homogenized, dried, and diluted 1 : 99 (w/v) in sterilized water. The diluted sample was incubated at 28°C inside an incubator and sampled once every two days (one mL sample per sampling time) till the 29^th day of postincubation (dpi) period. The collected samples were centrifuged at 12,000 rpm/min for 1 minute and the supernatants were discarded prior to the extraction of DNA from the pellets. For real-time PCR reactions, three technical replicates were analyzed and used to represent a specific DNA sample.

2.6. Detection of B. bassiana DNA in Soil Samples

One gram dried B. bassiana powder was mixed with 99 grams sterilized black soil, incubated at 28°C in an incubator and then sampled once every two days (1 g soil sample per sampling time) as described above. The collected soil samples (0.1 g each) were used for DNA extraction as described above. Real-time PCR was then performed using three technical replicates per sample.

2.7. Detection of B. bassiana DNA in Cotton (Gossypium spp.) Leaves Samples

One gram dried B. bassiana powder was diluted in 99 grams sterilized water and then spread onto the surface of cotton leaves. After air drying, three to four cotton leaf pieces were randomly collected once every two days. The sampled cotton leaf tissues were grounded in liquid nitrogen and 0.1 g powder from each leaf sample was used for DNA extraction. For real-time PCR, three technical replicates were used to represent a specific sample.

2.8. Detection of Different Number Spores of B. bassiana DNA on Chinese Cabbage (Brassica rapa Pekinensis) Leaves

The B. bassiana with 1.0 × 10² (A), 1.0 × 10⁴ (B), 1.0 × 10⁶ (C), 1.0 × 10⁷ (D), and 1.0 × 10⁸ (E) spores/mL were sprayed evenly on Chinese cabbage leaves at the same growth level at 28°C and 60% humidity. The buffer solution used for the dilution of the spores of B. bassiana was set as a blank control. The leaf samples were analyzed for B. bassiana DNA concentrations by real-time PCR after 24 hours of spraying, three to four pieces of cabbage leaf were randomly collected once every two days. For real-time PCR, three technical replicates were used to represent a specific sample.

2.9. Detection of Different Number Spores of B. bassiana DNA in P. rapae

The B. bassiana with 1.0 × 10² (A), 1.0 × 10⁴ (B), 1.0 × 10⁶ (C), 1.0 × 10⁷ (D), and 1.0 × 10⁸ (E) spores/mL were used to spray uniformly on the cabbage leaves. After spraying 12 hours, cabbage leaves were fed to 40 heads of P. rapae selected at normal active fourth stage larvae, the P. rapae larvae were cultured in a net cage at 28°C and 90% humidity. The buffer solution used for the dilution of the spores of B. bassiana was set as a blank control. After feeding for 24 hours, one P. rapae were randomly collected to check for the B. bassiana DNA concentrations by real-time PCR. The selected P. rapae was rinsed with water to avoid the presence of B. bassiana outside the body, which will affect the experimental results. For real-time PCR, three technical replicates were used to represent a specific sample.

In this study, all the experiments were repeated twice to ensure the repeatability of the results.

3. Data Analysis

Data obtained from three independent experiments were combined and analyzed by using one-way ANOVA program in Excel (Microsoft® Office Excel 2003, USA) and the SPSS 13.0 statistical software package (SPSS, Inc., Chicago, IL, USA). Post hoc multiple comparisons were conducted at the 5% level of probability using Duncan’s multiple range test (DMRT).

4. Results

4.1. Determination of Optimal PCR Primers and Standard Curve of Real-Time PCR

Gradient PCR was first used to determine the optimal annealing temperature for individual primer sets listed in supplementary Table 1. The recombinant plasmid DNA was diluted based on the copy number of plasmid DNA estimated using the following equation: copy numbers/μL = (6.0 × 10¹⁴ copies × plasmid concentration (g)/μL)/(number of bases × 660 Dalton/base). The efficiency of each primer set was determined through PCR reactions and the resulting PCR products were visualized in agarose gels through electrophoresis. Results of the assay showed that, when the annealing temperature was set at 54°C, four of the six primer sets gave strong and correct sized PCR product bands. At 52°C, three primer sets gave positive PCR products of different size, and at 56°C, only two primer sets gave positive PCR products (Supplementary Figure 1). Consequently, the 4^th primer set (e.g., 98F 5′GGCATCGATGAAGAACGCAG3′ and 333R 5′GTATTACTGCGCAGAGGTCG3′) was used for the following real-time PCR assays. Through PCR amplification assays, a standard curve of PCR was determined as Y = −3.26X + 11.25, R² = 0.99965, and the PCR amplification efficiency = 1.03 (Supplementary Figure 2). Using serially diluted plasmid DNA samples, it was observed that by the 10-fold dilution of DNA samples; the Ct values increased by 3-4. The concentration of standard plasmid DNA was found to be closely correlated with the Ct values, leading to single melting curves (Supplementary Figure 3).

4.2. Stability of B. bassiana in Water at 28°C

Dried B. bassiana powder was diluted in water and incubated at 28°C for several days followed by DNA isolation. Stability of B. bassiana DNA in water was determined as the concentrations of B. bassiana DNA in water over time by real-time PCR. The result of the assay showed that the amount of B. bassiana DNA in assayed samples stored for 1 and 3 days was similar (5.646 × 10⁶ and 5.622 × 10⁶ copies of B. bassiana DNA/μL, respectively) (Figure 1). The amount of B. bassiana DNA decreased quickly to 3.762 × 10⁶ copies of B. bassiana DNA/μL on the 7^th day of postinoculation period followed by an increase up to 6.619 × 10⁶ copies of B. bassiana DNA/μL on the 13^th day of postinoculation period. B. bassiana DNA decreased again at the 17^th dpi and maintained at a similar level till 29^th dpi. In this study, no B. bassiana DNA was detected in the negative control sample.

4.3. Stability of B. bassiana DNA in Soil at 28°C

Stability of B. bassiana DNA in soil was also determined by real-time PCR. Results shown in Figure 2 demonstrated that B. bassiana DNA concentration declined quickly from the 1^st dpi (5.253 × 10⁶ copies of B. bassiana DNA/μL) to the 9^th dpi (4.530 × 10⁵ copies of B. bassiana DNA/μL). As shown in Figure 2, B. bassiana DNA concentration rebound at the 11^th dpi and continued to increase till 17^th dpi (4.776 × 10⁶ copies of B. bassiana DNA/μL). After this increase, B. bassiana DNA concentration remained relatively stable till 29^th dpi, suggesting a reestablishment of B. bassiana population in soil samples. This experiment was repeated twice.

4.4. Stability of B. bassiana DNA on Cotton Leaves at 28°C

Dried B. bassiana powder was diluted in water and sprayed onto the surface of cotton leaves. After incubation at 28°C for several days, the leaf samples were analyzed for B. bassiana DNA concentrations by real-time PCR. The results shown in Figure 3 indicated that the concentration of B. bassiana DNA was at 3.202 × 10⁵ copies of B. bassiana DNA/μL at the 1^st dpi and then declined to 2.777 × 10⁴ copies of B. bassiana DNA/μL at the 9^th dpi. The concentration of B. bassiana DNA rebound at the 11^th dpi and reached 2.975 × 10⁵ copies of B. bassiana DNA/μL at the 17^th dpi. The B. bassiana DNA concentration decreased slightly again and reached 2.126 × 10⁵ copies of B. bassiana DNA/μL at the 21^st dpi, and then remained stabilized. This experiment was repeated twice. B. bassiana DNA was not detected in the negative control samples.

4.5. Stability of Different Number Spores of B. bassiana DNA on Chinese Cabbage Leaves at 28°C

To investigate the dynamics of different amounts of B. bassiana spores over time, we selected different concentrations of spores to spray on Chinese cabbage leaves and then detected the stability of B. bassiana DNA. Results shown in Figure 4 indicated that the concentration of B. bassiana DNA was at 7.976 × 10⁷ (A), 1.100 × 10⁸ (B), 1.308 × 10⁸ (C), 1.391 × 10⁸ (D), and 1.460 × 10⁸ (E) copies of B. bassiana DNA/μL at the 1^st dpi and then declined to 1.724 × 10⁷ (A), 5.261 × 10⁷ (B), 1.021 × 10⁸ (E) copies of B. bassiana DNA/μL at the 9^th dpi and 8.292 × 10⁷ (C), 9.076 × 10⁷ (D) copies of B. bassiana DNA/μL at the 7^th dpi. The concentration of B. bassiana DNA rebound at the 11^th dpi and reached 5.381 × 10⁷ (A), 1.156 × 10⁸ (B), 1.474 × 10⁸ (C), 1.553 × 10⁸ (D), and 1.615 × 10⁸ (E) copies of B. bassiana DNA/μL at the 21^st dpi and then remained stabilized. Although the concentration of B. bassiana was different, the stability of B. bassiana DNA on Chinese cabbage leaves surface showed roughly the same trend, which showed a decreasing trend from the 1^st dpi to the 9^th dpi (except (A), (B), and (E)), all concentrations showed an increasing trend from the 11^th dpi to the 19^th dpi and then remained stabilized at 21^th dpi to the 29^th dpi. This experiment was repeated twice. B. bassiana DNA was not detected in the negative control samples.

4.6. Stability of Different Number Spores of B. bassiana DNA in P. rapae at 28°C

After the different number of spores of B. bassiana spraying on cabbage leaves at 12 hours, the treated leaves were fed to P. rapae. Then, the assayed P. rapae were analyzed for B. bassiana DNA concentrations by real-time PCR. Results shown in Figure 5 indicated that the stability of B. bassiana DNA were 1.633 × 10⁸ (A), 2.854 × 10⁴ (B) copies of B. bassiana DNA/μL at the 7^th dpi; 4.574 × 10⁸ (C), 5.276 × 10⁸ (D), and 6.063 × 10⁸ (E) copies of B. bassiana DNA/μL at the 9^th dpi. The concentration of B. bassiana DNA rebound at the 11^th dpi and, respectively, reached 2.638 × 10⁸ (A), 6.953 × 10⁸ (B), 8.839 × 10⁸ (C), 8.887 × 10⁸ (D), and 9.263 × 10⁸ (E) copies of B. bassiana DNA/μL at the 21^st dpi. The mortality rate of P. rapae treated with different spores at 21^st, respectively, reached 15% (A), 50% (B), 65% (C), 90% (D), and 95% (E), the concentration of 1.0 × 10⁶ (C) spores/mL reached 65% at the 19^th dpi; the concentration of 1.0 × 10⁷ (D) spores/mL reached 50% at the 13^th dpi and reached 90% at the 21^st dpi; the concentration of 1.0 × 10⁸ (E) spores/mL reached 50% at the 14^th dpi, and reached 90% at the 19^st dpi. This experiment was repeated twice. B. bassiana DNA was not detected in the negative control samples.

5. Conclusion and Discussion

In this study, we identified a pair of PCR primers specific for the B. bassiana 16s rDNA and established a sensitive and reliable PCR and a real-time PCR method for the detection of B. bassiana in various substrates. The sensitivity of the detection technology was 4.337 × 10⁴ copies of plasmid/μL. Using this method, we can now reliably monitor B. bassiana population dynamics in B. bassiana preinoculated soil or cotton leaves samples. Our results indicated that during the 1^st to the 9^th dpi, B. bassiana DNA concentration declined in all substrates. According to our understanding, this decline was caused by the massive death of initially inoculated B. bassiana. The DNA concentration started to increase sharply after the 9^th till 11^th dpi. It is possible that this increase represents a rapid regrowth of B. bassiana, survived from the treatments. From the 11^th to the 29^th dpi, B. bassiana DNA concentrations remained high in all three substrates, suggesting that the B. bassiana population had reached the maximum level under the assayed conditions. In this study, B. bassiana DNA was not detected in any negative control samples and thus, the identified PCR primers produced the B. bassiana DNA specific bands when electrophoretically analyzed.

Different number spores of B. bassiana applied on Chinese cabbage result shown that the stability of B. bassiana DNA are consistent when plants treated with 1.0 × 10⁶, 1.0 × 10⁷, and 1.0 × 10⁸ spores/mL. But the mortality rate of P. rapae treated with different spores at 21^st, respectively, reached 15%, 50%, 65%, 90%, and 95%, the concentration of 1.0 × 10⁶ spores/mL reached 65% at the 19^th dpi; the concentration of 1.0 × 10⁷ spores/mL reached 50% at the 13^th dpi and reached 90% at the 21^st dpi; the concentration of 1.0 × 10⁸ spores/mL reached 50% at the 14^th dpi, and reached 90% at the 19^st dpi. With the increase in the initial spores of B. bassiana, the mortality of P. rapae gradually increased. At low spores (1.0 × 10² spores/mL and 1.0 × 10⁴ spores/mL), the death rate was approximately 15–50%. At high spores (1.0 × 10⁶, 1.0 × 10⁷, and 1.0 × 10⁸ spores/mL), the death rate was 65–95%. The results indicated the effect of killing insects was obviously increased with increasing the concentration of B. bassiana, whereas considering the cost-effectiveness, the 1.0 × 10⁷ spores/mL of B. bassiana was the most suitable.

Since the invention of real-time PCR, this technology has been widely applied to molecular biology studies [28]. Currently, PCR, and real-time PCR are the most popular technologies for plant pathogen diagnosis [29, 30] and host gene expression analysis. The potential of this technology for the assays on the stability of the inoculated biocontrol agents remained largely unknown. The main reason for this is mainly due to the lack of specific PCR primers. Current studies on B. bassiana field applications focused mainly on the development of antibiotic-resistant strains [31–33]. The development of antibiotic-resistant B. bassiana is, however, time-consuming and the resulting resistance strain(s) might become attenuated after a few generations. In contrast, understanding the environmental impacts on B. bassiana stability and recolonization behavior in the field can facilitate the design and establishment of more effective insect pest management strategies and thus achieving a better control effect. This PCR detection technology may also be modified for other biocontrol agents. In summary, this study has established a fast, low-cost, and reliable method for the determination of B. bassiana stability and recolonization in various substrates under the controlled conditions.

Abbreviations

B. bassiana:	Beauveria bassiana
dpi:	Day of post inoculation
P. rapae:	Pieris rapae
PCR:	Polymerase chain reaction.

Data Availability

The data that support the findings of this study are openly available at https://figshare.com/s/b65294b7548715e34c85.

Disclosure

Zepei Gu, Lijie Chen, and Weixing Zhang are the co-first authors.

Conflicts of Interest

The authors declare that there are no conflicts of interest.

Authors’ Contributions

ZG, LC, PS, YL, XL, and DZ designed the experiments and analyzed the data. ZG, LC, PS, and WZ performed the experiments. WZ and QP provided some reagents/materials. ZG, LC, XL, and LY wrote the paper.

Acknowledgments

The study was supported by Key Research and Development Program of Hunan Province (Grant no. 2022NK2014), Agricultural Science and Technology Innovation Fund Project of Hunan Province (Grant no. 2022CX1), and Hunan Natural Science Foundation (Grant no. 2022JJ40234).

Supplementary Materials

Supplementary Figure S1: gradient PCR products separated in an agarose gel after electrophoresis. Supplementary Figure S2: standard curve of qRT-PCR. Supplementary Figure S3: qRT-PCR curves determined using different concentrations of plasmid DNA. Supplementary Table 1: six sets of PCR primers used in this study. (Supplementary Materials)

References

C. A. Valero-Jiménez, A. J. Debets, J. A. van Kan et al., “Natural variation in virulence of the entomopathogenic fungus Beauveria bassiana against malaria mosquitoes,” Malaria Journal, vol. 13, no. 1, p. 479, 2014.
View at: Publisher Site | Google Scholar
G. M. Mascarin and S. T. Jaronski, “The production and uses of Beauveria bassiana as a microbial insecticide,” World Journal of Microbiology and Biotechnology, vol. 32, no. 11, p. 177, 2016.
View at: Publisher Site | Google Scholar
J. Li, S. H. Ying, L. T. Shan, and M. G. Feng, “A new non-hydrophobic cell wall protein (CWP10) of Metarhizium anisopliae enhances conidial hydrophobicity when expressed in Beauveria bassiana,” Applied Microbiology and Biotechnology, vol. 85, no. 4, pp. 975–984, 2010.
View at: Publisher Site | Google Scholar
J. Poidatz, R. López Plantey, and D. Thiéry, “Indigenous strains of Beauveria and Metharizium as potential biological control agents against the invasive hornet vespa velutina,” Journal of Invertebrate Pathology, vol. 153, pp. 180–185, 2018.
View at: Publisher Site | Google Scholar
Z. Zhang, Y. Lu, W. Xu et al., “Influence of genetic diversity of seventeen Beauveria bassiana isolates from different hosts on virulence by comparative genomics,” BMC Genomics, vol. 21, no. 1, p. 451, 2020.
View at: Publisher Site | Google Scholar
Y. Fan, D. Borovsky, C. Hawkings, A. Ortiz-Urquiza, and N. O. Keyhani, “Exploiting host molecules to augment mycoinsecticide virulence,” Nature Biotechnology, vol. 30, no. 1, pp. 35–37, 2012.
View at: Publisher Site | Google Scholar
I. Skrzecz, E. Popowska-Nowak, R. Wolski et al., “The role of fungus Beauveria bassiana in reducing the number of Pissodes castaneus (Col., Curculionidae) in young forests,” Folia Forestalia Polonica, vol. 58, no. 4, pp. 214–219, 2016.
View at: Publisher Site | Google Scholar
K. M. A. Rahman, M. Barta, and L. Cagáň, “Effects of combining Beauveria bassiana and Nosema pyrausta on the mortality of Ostrinia nubilalis,” Central European Journal of Biology, vol. 5, pp. 472–480, 2010.
View at: Google Scholar
S. A. A. Alawaash, “Evaluation of the entomopathogenic fungus Beauveria bassiana and its prospects in controlling the red plam weevil, Rhynchophorus ferrugineus olivier,” Egypt J. Biol. Pest. Control, vol. 21, no. 2, pp. 125–129, 2011.
View at: Google Scholar
V. A. M. Andaló, A. Moino Jr, L. V. Santa-Cecília, and G. C. Souza, “Compatibility of Beauveria bassiana with chemical pesticides for the control of the coffee root mealybug Dysmicoccus texensis Tinsley (Hemiptera: pseudococcidae),” Neotropical Entomology, vol. 33, no. 4, pp. 463–467, 2004.
View at: Publisher Site | Google Scholar
V. A. M. D. Carvalho, “Evaluation of entomopathogenic fungi and nematodes and their compatibility to pesticides for the control of the coffee root mealybug,” Dysmicoccus Texensis (Tinsley), vol. 4, 2003.
View at: Google Scholar
L. Sharma, I. Oliveira, F. Gonçalves et al., “Effect of soil chemical properties on the occurrence and distribution of entomopathogenic fungi in Portuguese grapevine fields,” Pathogens, vol. 10, no. 2, p. 137, 2021.
View at: Publisher Site | Google Scholar
L. St, L. Joshi, M. J. Bidochka, N. W. Rizzo, and D. W. Roberts, “Characterization and ultrastructural localization of chitinases from Metarhizium anisopliae, M. flavoviride, and Beauveria bassiana during fungal invasion of host (Manduca sexta) cuticle,” Applied and Environmental Microbiology, vol. 62, no. 3, pp. 907–912, 1996.
View at: Publisher Site | Google Scholar
J. Do Nascimento Silva, G. M. Mascarin, I. C. Dos Santos Gomes et al., “New cost-effective bioconversion process of palm kernel cake into bioinsecticides based on Beauveria bassiana and Isaria javanica,” Applied Microbiology and Biotechnology, vol. 102, no. 6, pp. 2595–2606, 2018.
View at: Publisher Site | Google Scholar
S. Khan, S. Nadir, X. Wang et al., “Using in silico techniques: isolation and characterization of an insect cuticle-degrading-protease gene from Beauveria bassiana,” Microbial Pathogenesis, vol. 97, pp. 189–197, 2016.
View at: Publisher Site | Google Scholar
Z. Li, S. B. Alves, D. W. Roberts et al., “Biological control of insects in Brazil and China: history, current programs and reasons for their successes using entomopathogenic fungi,” Biocontrol Science and Technology, vol. 20, no. 2, pp. 117–136, 2010.
View at: Publisher Site | Google Scholar
N. O. Keyhani, “Lipid biology in fungal stress and virulence: entomopathogenic fungi,” Fungal Biology, vol. 122, no. 6, pp. 420–429, 2018.
View at: Publisher Site | Google Scholar
M. G. Rojas, R. B. Elliott, and J. A. Morales-Ramos, “Mortality of Solenopsis invicta workers (Hymenoptera: formicidae) after indirect exposure to spores of three entomopathogenic fungi,” Journal of Insect Science, vol. 18, no. 3, p. 20, 2018.
View at: Publisher Site | Google Scholar
C. X. Li and S. H. Zhang, “A review ofstudy on virulence of Beauveria bassiana against pests,” Journal of Tangshang Teachers College, 2005.
View at: Google Scholar
C. Yuhong, B. Yun, C. Na, L. Yihao, G. A. Bugti, and W. Bin, “Effects of Beauveria bassiana inoculated with different methods on maize as growth promoter,” Chinese Journal of Topical Crops, vol. 38, pp. 206–212, 2017.
View at: Google Scholar
H. He and Z. Li, “Effects of Beauveria bassiana on the fecundity and population parameters of Myzus persicae at different temperatures,” Chinese Bulletin of Entomology, vol. 45, no. 1, pp. 101–104, 2008.
View at: Google Scholar
M. Fernández-Bravo, I. Garrido-Jurado, P. Valverde-García, J. Enkerli, and E. Quesada-Moraga, “Responses to abiotic environmental stresses among phylloplane and soil isolates of Beauveria bassiana from two holm oak ecosystems,” Journal of Invertebrate Pathology, vol. 141, pp. 6–17, 2016.
View at: Publisher Site | Google Scholar
X. Jin, Y. Mao-Fa, D. Xue-Yuan, S. Pei-Qiong, Z. Xiao, and G. University, “Field control effects of Beauveria bassiana strain YS03 on rice water weevil, Southwest Chin,” The Journal of Agricultural Sciences, vol. 28, pp. 1630–1633, 2015.
View at: Google Scholar
C. Wang, F. A. Shah, N. Patel, Z. Li, and T. M. Butt, “Molecular investigation on strain genetic relatedness and population structure of Beauveria bassiana,” Environmental Microbiology, vol. 5, no. 10, pp. 908–915, 2003.
View at: Publisher Site | Google Scholar
G. Peng, Z. Wang, Y. Yin, D. Zeng, and Y. Xia, “Field trials of Metarhizium anisopliae var. acridum (Ascomycota: hypocreales) against oriental migratory locusts, locusta migratoria manilensis (Meyen) in northern China,” Crop Protection, vol. 27, no. 9, pp. 1244–1250, 2008.
View at: Publisher Site | Google Scholar
R. D. O'Kennedy, C. Baldwin, and E. Keshavarz-Moore, “Effects of growth medium selection on plasmid DNA production and initial processing steps,” J. Biotechnol, vol. 76, no. 2-3, pp. 175–183, 2000.
View at: Google Scholar
C. Lee, J. Kim, S. G. Shin, and S. Hwang, “Absolute and relative QPCR quantification of plasmid copy number in Escherichia coli,” Journal of Biotechnology, vol. 123, no. 3, pp. 273–280, 2006.
View at: Publisher Site | Google Scholar
R. Sanders, J. F. Huggett, C. A. Bushell, S. Cowen, D. J. Scott, and C. A. Foy, “Evaluation of digital PCR for absolute DNA quantification,” Analytical Chemistry, vol. 83, no. 17, pp. 6474–6484, 2011.
View at: Publisher Site | Google Scholar
R. Netzer, D. Ribičić, M. Aas, L. Cavé, and T. Dhawan, “Absolute quantification of priority bacteria in aquaculture using digital PCR,” Journal of Microbiological Methods, vol. 183, Article ID 106171, 2021.
View at: Publisher Site | Google Scholar
R. B. Sa, J. L. Zhang, J. Z. Sun, and Y. X. Gao, “Colonization characteristics of poplar fungal disease biocontrol bacteria N6-34 and the inhibitory effect on pathogenic fungi by real-time fluorescence quantitative PCR detection,” Current Microbiology, vol. 78, no. 8, pp. 2916–2925, 2021.
View at: Publisher Site | Google Scholar
K. Jin, Y. Zhang, Z. Luo, J. Lin, and Y. Pei, “GFP as a vital marker for investigation of pathogenic development of Beauveria bassiana,” Mycosystema, vol. 27, no. 3, pp. 377–384, 2008.
View at: Google Scholar
M. Faria and S. P. Wraight, “Biological control of Bemisia tabaci with fungi,” Crop Protection, vol. 20, no. 9, pp. 767–778, 2001.
View at: Publisher Site | Google Scholar
I. Sani, S. I. Ismail, S. Abdullah, J. Jalinas, S. Jamian, and N. Saad, “A review of the biology and control of whitefly, Bemisia tabaci (Hemiptera: aleyrodidae), with special reference to biological control using entomopathogenic fungi,” Insects, vol. 11, no. 9, p. 619, 2020.
View at: Publisher Site | Google Scholar

Copyright

Copyright © 2023 Zepei Gu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PDF Download Citation

Download other formats

Order printed copies

Views

307

Downloads

249

Citations