Research Article

Antimicrobial Resistance Factors of Extended-Spectrum Beta-Lactamases Producing Escherichia coli and Klebsiella pneumoniae Isolated from Cattle Farms and Raw Beef in North-West Province, South Africa

Table 1

Oligonucleotide primer sequences used for amplification of 16S rRNA universal, uspA, uidA, and ntrA genes and PCR cycling conditions used.

PrimersSequence (5′–3′)Targeted geneAmplicon size (bp)PCR conditions and cyclesReference

27FAGAGTTTGATCATGGCTCAG16S rRNA14201 cycle of 3 minutes at 94°C, 25 cycles of 1 minute at 94°C, 1 minute at 55°C, 2 minutes at 72°C; 1 cycle of 10 minutes at 72°C[21]
1492RGGTACCTTGTTACGACTT
uspAFCCGATACGCTGCCAATCAGTuspA8841 cycle of 5 minutes at 95°C, 30 cycles of 30 seconds at 94°C, 30 seconds at 56°C, 30 seconds at 72°C; 1 cycle of 5 minutes at 72°C[22]
uspARACGCAGACCGTAGGCCAGAT
uidAFCTGGTATCAGCGCGAAGTCTuidA5561 cycle of 10 minutes at 95°C, 35 cycles of 45 seconds at 95°C, 30 seconds at 59°C, 1 minute 30 seconds at 72°C; 1 cycle of 10 minutes at 72°C[23]
uidARAGCGGGTAGATATCACACTC
ntrACATCTCGATCTGCTGGCCAAntrA901 cycle of 10 minutes at 95°C, 35 cycles of 45 seconds at 95°C, 30 seconds at 55°C, 1 minute 30 seconds at 72°C; 1 cycle of 10 minutes at 72°C
ntrAGCGCGGATCCAGCGATTGGA