Abundance of Gut Microbiota, Concentration of Short-Chain Fatty Acids, and Inflammatory Markers Associated with Elevated Body Fat, Overweight, and Obesity in Female Adolescents

Table 1

Specific indicator sequences for RT-qPCR analysis (Viçosa, MG, Brazil, 2019).

Groups	Primers (S and A)	Standard genomic DNA	References
Total bacteria	S—GCAGGCCTAACACATGCAAGTC	Escherichia coli	Castillo et al. [20].
	A—CTGCTGCCTCCCGTAGGAGT
Bacteroidetes	S—CATGTGGTTTAATTCGATGAT	Bacteroides vulgatus	Guo et al. [21]
	A—AGCTGACGACAACCATGCAG
Firmicutes	S—ATGTGGTTTAATTCGAAGCA	Lactobacillus delbrueckii	Guo et al. [21]
	A—AGCTGACGACAACCATGCAC
Proteobacteria	S—CATGACGTTACCCGCAGAAGAAG	Escherichia coli	Friswell et al. [22]
	A—CTCTACGAGACTCAAGCTTGC

RT-qPCR: real-time polymerase chain reaction; S: sense; A: antisense. All oligonucleotides were purchased from Alpha DNA and Molecular Diagnostics.