Mediators of Inflammation / 2011 / Article / Tab 1

Research Article

Dual Specificity Phosphatase 1 Regulates Human Inducible Nitric Oxide Synthase Expression by p38 MAP Kinase

Table 1

Primer and probe sequences for quantitative RT-PCR.

GeneOligonucleotideSequenceConc. (nM)

Human GAPDHForward primerTCCTACCACCAGCAACCCTGCCA300
Reverse primerGCAACAATATCCACTTTACCAGAGTTAA300
ProbeCGCCTGGTCACCAGGGCTGC150
Human iNOSForward primerGCAGGTCGACTATTTCTTTCA300
Reverse primerTCCTCCTCCGCCTCGTAAGGA300
ProbeTCAAGAGCCAGAAGCGCTATCACGAAGATA150
Mouse GAPDHForward primerGCATGGCCTTCCGTGTTC300
Reverse primerGATGTCATCATACTTGGCAGGTTT300
ProbeTCGTGGATCTGACGTGCCGCC150
Mouse iNOSForward primerCCTGGTACGGGCATTGCT300
Reverse primerGCTCATGCGGCCTCCTT300
ProbeCAGCAGCGGCTCCATGACTCCC150
Mouse DUSP1Forward primerCTCCTGGTTCAACGAGGCTATT300
Reverse primerTGCCGGCCTGGCAAT300
ProbeCCATCAAGGATGCTGGAGGGAGAGTGTT150

You are browsing a BETA version of Hindawi.com. Click here to switch back to the original design.