Research Article
No Polymorphism in Plasmodium falciparum K13 Propeller Gene in Clinical Isolates from Kolkata, India
Table 1
Primers and PCR conditions of primary and nested PCR of K13 gene.
| Primer name |
Primer sequence (5′-3′) | Mg2+ | PCR programme | Conc. | Denaturation | Annealing | Elongation | Number of cycles | (mM) | Temp. | Time | Temp. | Time | Temp. | Time | 1st | 2nd | (°C) | (min) | (°C) | (min) | (°C) | (min) | PCR | PCR |
| K13_PCR_F K13_PCR_R | CGGAGTGACCAAATCTGGGA GGGAATCTGGTGGTAACAGC | 3 | 94 | 0:30 | 60 | 1:30 | 72 | 1:30 | 40 | — |
| K13_N1_F K13_N1_R | GCCAAGCTGCCATTCATTTG GCCTTGTTGAAAGAAGCAGA | 2.5 | 94 | 0:30 | 60 | 1:30 | 72 | 1:30 | — | 40 |
|
|