Abstract
The Mekong River and its tributaries possess the second highest diversity in fish species in the world. However, the fish biodiversity in this river is threatened by several human activities, such as hydropower plant construction. Understanding the genetic diversity and genetic structure of the species is important for natural resource management. Belodontichthys truncatus Kottelat & Ng is endemic to the Mekong River basin and is an important food source for people in this area. In this study, the genetic diversity, genetic structure, and demographic history of the twisted-jaw fish, B. truncatus, were investigated using mitochondrial cytochrome b gene sequences. A total of 124 fish specimens were collected from 10 locations in the Mekong and its tributaries. Relatively high genetic diversity was found in populations of B. truncatus compared to other catfish species in the Mekong River. The genetic structure analysis revealed that a population from the Chi River in Thailand was genetically significantly different from other populations, which is possibly due to the effect of genetic drift. Demographic history analysis indicated that B. truncatus has undergone recent demographic expansion dating back to the end of the Pleistocene glaciation.
1. Introduction
The Mekong is the second most biodiverse river for fish species. It has been estimated that more than 877 fish species can be recorded in the Mekong and its tributaries [1]. However, many species are under threat due to human-mediated environmental change, such as hydropower dam construction [1, 2].
The twisted-jaw catfish (Belodontichthys truncatus Kottelat & Ng) is endemic to the Mekong basin [3]. Two species of the genus Belodontichthys are found in the Mekong and its tributaries, including B. dinema Bleeker, 1851, and B. truncatus. The former species occur in central and southern Thailand, Malaysia, Sumatra, and Borneo, while the latter species is found in northeast Thailand, Lao PDR, Cambodia, and Vietnam [3]. Belodontichthys truncatus is a very important species for fisheries in Lao PDR and Cambodia where the fish is caught and exported to Thailand [4]. However, there is no information on the genetic diversity and genetic structure of this important fish, despite being important for natural resource management [5].
In this study, we used the mitochondrial cytochrome b (cyt b) sequences to examine the genetic diversity, genetic structure, and demographic history of B. truncatus in the Mekong and two of its tributaries, the Chi and Mun Rivers in northeastern Thailand. Previous studies indicated that cyt b sequences can be successfully used to infer genetic structure and demographic history of freshwater fishes [6–8]. The information presented in this study will be useful for the management of B. truncatus. In addition, because this species is widely distributed in the Mekong and its tributaries, understanding its genetic structure and demographic history would shed some light on the effect of historical change (e.g., Pleistocene climatic and environmental change) on fish biodiversity.
2. Materials and Methods
2.1. Specimen Collection and Identification
A total of 124 fish specimens were collected from seven locations in Thailand and Cambodia (Table 1 and Figure 1). Among these locations, one was from the Chi River and one from the Mun River; both of these are in northeastern Thailand. Three sites were from the Mekong River along the Thailand-Lao PDR border, one from the Mekong River in Cambodia and one from Tonle Sap Lake in Cambodia. Specimens were identified following the description of Belodontichthys truncatus by Kottelat & Ng [3].
2.2. DNA Extraction, Polymerase Chain Reaction, and Sequencing
Genomic DNA was extracted from the tissue using the Genomic DNA Extraction mini kit (RBC BioScience, Xindian City, Taiwan). A fragment of the cytochrome b (cyt b) gene was amplified using the primers Glu31 (5′GTGACTTGAAAAACCACCGTT3′) and Cat.Thr29 (5′ACCTTCGATCTCCTGATTACAAGAC3′) [9]. The amplification reaction with a total volume of 50 μl contained 2 µl MgCl2 (50 mM), 5 µl of 10x PCR buffer, 1.6 µl of mixed dNTPs (10 µM), 2 µl of each primer (10 µM), 0.4 µl of Taq DNA polymerase (5 u/µl), and 2 µl DNA temple. The temperature profile was as follows: 94°C for 3 min, followed by 35 cycles of 94°C for 30 seconds, 48°C for 1 min, and 72°C for 1.30 min with a final extension at 72°C for 7 min [10]. The PCR products were checked by 1% agarose gel electrophoresis and purified using a High Yield Gel/PCR DNA fragment extraction kit (RBC BioScience, Taiwan). Sequencing was performed at the Macrogen DNA sequencing service (Seoul, Korea) using the same primers as in the PCR.
2.3. Data Analysis
A fragment of 1,024 bp of the cyt b gene was obtained from 124 specimens. Sequences were deposited in GenBank under the accession numbers KY607016–KY607139. Genealogical relationships between haplotypes were estimated using a median joining (MJ) network (Bandelt et al., 1999) calculated using Network v 4.6.1.0 (http://www.fluxus-engineering.com). Haplotype diversity and nucleotide diversity were calculated using Arlequin ver. 3.5 [11]. The population pairwise calculated in Arlequin was used to infer the genetic structure. The significance test statistic was obtained from 1,023 permutations. To avoid bias, due to a small sample size, populations with less than five specimens were omitted from the genetic structure analysis. A Mantel test [12] was used to determine the relationship between the genetic distance ( from Arlequin) and the geographical distance (km) for an isolation-by-distance (IBD) model. The Mantel test was implemented in IBD ver. 1.52 [13] using 1,000 randomizations. The mismatch distribution was used to test the signature of the population expansion. Populations that have undergone a recent past demographic expansion show a unimodal mismatch distribution [14]. The sum-of-squares deviation and Harpending’s raggedness index [15] were used to test the deviation from the sudden expansion model. A mismatch distribution was estimated using Arlequin. Fu’s [16] and Tajima’s D [17] statistical tests were used to test the population equilibrium. A large negative value from these tests was expected for the demographic expansion.
3. Results
3.1. Genetic Diversity
A total of 124 sequences from seven sampling locations were obtained in this study, and 40 haplotypes were identified. Haplotype diversity in each location ranged between 0 in two populations (CHYT and CHMK) of the Chi River in northeastern Thailand and 0.9487 in Nong Khai Province (MKNK) for the Mekong River with an overall average of 0.9765 (Table 1). The nucleotide diversity in each population ranged from 0 in two populations (CHYT and CHMK) of the Chi River to 0.0041 in Nong Khai Province (MKNK) for the Mekong River with an overall average of 0.0032 (Table 1).
3.2. Mitochondrial DNA Genealogy
The median joining network (Figure 2) revealed no major phylogeographic breaks among the 124 sequences included in the analysis. There is no evidence of geographic association between the haplotypes. The core haplotype that has the highest frequency is shared by 35 specimens from all three major rivers (Mekong, Chi and Mun) of the Mekong Basin. Overall, the haplotype is a star-like shape, which is the characteristic of a recent expansion in the population.
3.3. Genetic Structure
The population pairwise revealed an overall low level of genetic structuring between the populations of Belodontichthys truncatus. No significant values were observed except for comparisons between a population (CHRO2) from the Chi River and the other populations, where most were significantly different (Table 2). A Mantel test revealed no significant relationships between the genetic and geographic distances (, ).
3.4. Demographic History
A mismatch distribution analysis revealed a unimodal mismatch graph (Figure 3), which is a characteristic of a recently expanding population that is consistent with the star-like shape of the mtDNA genealogy. Harpending’s raggedness index (0.0349, ) and the sum-of-squares deviation (SSD = 0.0047, ) were not significantly different from the simulated data under the sudden population expansion model. Population expansion was also supported by highly significant negative values for both Tajima’s D (, ) and Fu’s (, ). The expansion time, estimated based on the fish cyt b evolutionary rate of 1% Myr [18] and assuming a generation time of two years for B. truncatus, was 20,458 years ago.
4. Discussion
The levels of genetic diversity observed in B. truncatus (, ) based on the cyt b mtDNA sequences are similar to other fish species of the family Siluridae. For example, butter catfish, Ompok bimaculatus, in India (, ) [19] and Trichomycterus areolatus from Chile [8]. However, the genetic diversity found in B. truncatus is higher than other catfish species from the Mekong River [20].
Mismatch distribution analysis indicated a recent demographic expansion in B. truncatus that dated back to 20,458 years ago, which is at the end of the last glaciation. Previous studies found a significant influence from the Pleistocene glaciation on genetic diversity, genetic structure, and demographic history in many Southeast Asian floras and faunas [e.g., [21–23]]. During the Pleistocene glaciations, climatic and environmental conditions in Southeast Asia were cooler and drier [24]. Evidence indicated that the water level and water flow in large rivers in Southeast Asia, including the Mekong, reduced during the Pleistocene glaciation [25]. After the climatic conditions recovered at the end of the Pleistocene, the water level and water flow increased, which could trigger the population expansion in B. truncatus.
The population genetic structure analysis based on the values revealed that a population from the Chi River was genetically significantly different from almost all other populations from the Mekong but not from the Mun River. Mitochondrial genealogy indicated no evidence of divergent lineages for B. truncatus from different rivers, thus indicating that the genetic differentiation between the Chi and Mekong River populations is likely to be a recent event. The sharing of the mtDNA haplotypes between fish from these rivers suggests that there is some gene flow between these populations. There are two possible explanations for the significant genetic differentiations between the populations from the Chi River and the Mekong River. The Chi River is part of the Mekong, and it originates from a mountainous area in the upper part of northeastern Thailand. The Chi River joins the Mun River in Ubon Ratchathani Province and then flows into the Mekong. Near the location (approximately 5.5 km) of the Mun and Mekong confluence, there is a dam (Pak Mun dam) that was constructed in 1994. This dam could be a barrier to gene flow between B. truncatus populations in the Chi and Mun Rivers and the Mekong. The effects of dams on gene flow have been investigated in other fish species [26–28]. However, given that this dam is only 23 years old, it is unlikely to have had an impact on the genetic structure. The more likely explanation for the genetic differentiation of the Chi River populations from the Mekong River is the effect of genetic drift. It has been suggested that the random sampling of the alleles from the source population of the colonizer could lead to the genetic differentiation of the population by the effect of genetic drift [29]. Although populations from the Chi River possess considerable genetic diversity, the relatively low haplotype diversity in this population (0.5055), compared to the others that contributed to the significant pairwise values, supports genetic drift playing a role in the genetic differentiation.
5. Conclusion
We found that the genetic diversity of B. truncatus is considerable compared to other fishes in the Mekong. This implies a large effective population size for this species. The results showed significant genetic differentiation for the population from a Mekong tributary, the Chi River, in Thailand that was genetically significantly different from the other populations due to the effect of genetic drift. We also found that historical environmental change during the Pleistocene has had an effect on the demographic history of this species. Given the recent rapid changes in the Mekong and its tributaries, particularly for the hydropower dam construction, which is predicted to have an effect on the fish productivity and biodiversity [1], further studies should examine the effect of this on genetic structure and diversity on the fish species.
Conflicts of Interest
The authors declare that they have no conflicts of interest.
Acknowledgments
This study was financially supported by a grant from Mahasarakham University.