Melatonin Alleviates Neonatal Necrotizing Enterocolitis by Repressing the Activation of the NLRP3 Inflammasome

Xiong, Xiaoyu; Bao, Zhongkun; Mi, Yanhong; Wang, Xinhong; Zhu, Jiajun

doi:https://doi.org/10.1155/2022/6920577

Gastroenterology Research and Practice

On this page

Abstract Introduction Materials and Methods Results Discussion Conclusion Data Availability Conflicts of Interest Authors’ Contributions Acknowledgments References Copyright Related Articles

Research Article | Open Access

Volume 2022 | Article ID 6920577 | https://doi.org/10.1155/2022/6920577

Melatonin Alleviates Neonatal Necrotizing Enterocolitis by Repressing the Activation of the NLRP3 Inflammasome

Xiaoyu Xiong,¹Zhongkun Bao,²Yanhong Mi,²Xinhong Wang,³and Jiajun Zhu¹

Academic Editor: Amosy M'Koma

Received05 Nov 2021

Revised22 Feb 2022

Accepted26 Feb 2022

Published17 Mar 2022

Abstract

Objective. Necrotizing enterocolitis (NEC) is one of the commonest gastrointestinal critical diseases in newborns. Several researches have proven the efficacy of melatonin (MEL) on NEC, but the latent mechanisms were ambiguous. We designed the current research to evaluate the function and mechanism of MEL on NEC in a neonatal mouse model. Methods. The newborn mice were subjected to formula milk containing LPS and hypoxia to establish a NEC model and also intraperitoneally injected with MEL. During the experiment, all mice were closely monitored and weighed. The effect of MEL on the histopathological injury of the terminal ileum tissues, inflammation, and oxidative stress of serum in NEC mice was examined by hematoxylin-eosin (H&E) staining and ELISA. The effect of MEL on the NOD-like receptor family pyrin domain containing 3 (NLRP3) inflammasome was assessed via quantitative real-time PCR and Western blot. Results. MEL intensified the survival rate and body weight in NEC mice. The H&E staining illustrated that MEL improved the histopathological injury in NEC mice. Moreover, MEL repressed the IL-1β, TNF-α, and MDA levels of serum and enhanced the SOD and GSH-Px levels of serum in NEC mice. We also discovered that MEL attenuated the mRNA and protein levels of NLRP3, Toll-like Receptor 4 (TLR4), NF-κB, and caspase-1 of the terminal ileum tissues in NEC mice. Conclusion. Our research illuminated that MEL attenuated the severity of NEC via weakening the activation of the NLRP3 inflammasome.

1. Introduction

Necrotizing enterocolitis (NEC) is a serious gastrointestinal disease that occurs in neonates [1]. NEC often leads to systemic sepsis, multiple organ failure, and even death, which seriously threatens the health of neonates. NEC is characterized by intestinal injury (from mucosal injury to full-thickness necrosis and perforation), and its clinical manifestations are mainly feeding intolerance, shock, abdominal distension, and intestinal bleeding [2, 3]. It was proven that more than 90% of NEC patients are preterm infants, especially very low birth weight babies () [4]. Since the discovery of NEC, many advances have been made in etiology, diagnosis, and treatment, but there are also some mechanisms that have not yet been elucidated [5]. Due to the unclear pathogenesis, the current prevention and treatment methods of NEC are also limited, mainly including breastfeeding, probiotics, antibiotics, and surgery [6, 7]. However, antibiotics cannot be used for a long time [8]; surgery can also cause a series of complications, such as sepsis, peritonitis, and wound infection, and the postoperative mortality and reoperation rates are both high (postoperative mortality is about 40%-50%, and the complication rate is about 40%-70%) [9]. Therefore, finding new and effective therapeutic targets and drugs is the focus of current research.

Mounting evidence manifested that inflammatory response generates a critical function in the progression of NEC [10, 11]. NOD-like receptor family pyrin domain-containing 3 (NLRP3), as a protein complex, is composed of upstream NLRP3, apoptosis-associated speck like protein (ASC), and caspase-1 [12]. The NLRP3 inflammasome responds to multiple signals. The activation of the NF-κB pathway upregulates the expressions of NLRP3 and pro-IL-1β, while the activated NLRP3 inflammasome promotes neutrophil recruitment, leading to acute inflammatory responses [13]. The results exhibited that NLRP3 is involved in the inflammatory response during the development of NEC, so the effective inhibition of the activation of the NLRP3 inflammasome may provide insights for the development of new drugs for the therapy of NEC [14].

Melatonin (MEL), a neuroendocrine hormone secreted by the pineal gland, is a derivative of 5-hydroxytryptophan [15]. MEL has a variety of physiological functions, including anti-inflammatory, antioxidant, immune regulation, biological rhythm modulation, and tumor prevention [16, 17]. It was proven that MEL can inhibit the inflammatory response by weakening NLRP3 inflammasome activation in the process of atherosclerosis, acute lung injury, and hypoxic-ischemic brain injury [18–20]. Scientific research proved that MEL alleviated NEC via preventing Th17/Treg imbalance by AMPK/SIRT1 signaling activation [21]. Guven et al. illustrated that MEL notably attenuated the severity of NEC in a neonatal rat model [22]. However, whether MEL ameliorates NEC intestinal inflammatory damage by restraining the inflammatory response mediated by the NLRP3 inflammasome remains fuzzy.

Based on the above research evidence, this study constructed a neonatal NEC mouse model to probe the influence of MEL on intestinal inflammatory injury of neonatal NEC and its effect on the activation of the NLRP3 inflammasome in intestinal tissues, in order to provide new ideas and theoretical foundation for the therapy of neonatal NEC.

2. Materials and Methods

2.1. Ethics Statement

The animal experiment protocols were performed based on the guidelines of the China Animal Care and Use Committee. The research was ratified by Hangzhou Eyong Biotechnological Co., Ltd. Animal Experiment Center (Certificate No. SYXK (Zhe)2020-0024). All efforts were made to mitigate the agony of animals.

2.2. Experimental Animal

A total of 36 ten-day-old C57BL/6 mice with SPF grade were acquired from Shanghai Sippr-BK Laboratory Animal Co., Ltd. (Certificate No. SCXK (Hu)2018-0006; Shanghai, China). All mice were raised in a clean facility (22-24°C, relative humidity of 40–60%, under a 12 h day-night cycle) with free access to standard rodent chow and water.

2.3. NEC Model Establishment and Grouping

The mice were distributed into the control group (control), model group (NEC), and NEC+MEL group, with 12 mice in each group. The mice in the control group were fed in the same cage as the mother mice without other treatments. The mice in the NEC group were subjected to formula milk and hypoxia to establish a NEC model [21]. Briefly, mice were given formula milk (Similac Advance Infant Formula: Puppy-Canine Milk replacement, 2 : 1) for 4 days, and 4 μg/g/day LPS was placed into the infant formula on days 2 and 3. Simultaneously, the mice were placed in a modular chamber containing 5% O₂ and 95% N₂ for 10 min, twice a day for 4 days. Each mouse in the NEC+MEL group was intraperitoneally injected with 100 μL of MEL (M5250, Sigma-Aldrich, USA) at a dose of 10 mg/kg per day before the NEC module processing until the end of the experiment. The MEL in this study was dissolved in 0.9% NaCl and immediately administered to mice. Mice in the other groups were subjected to 0.9% NaCl in the same way. All mice were closely monitored and weighed at days 10, 12, and 14 after birth.

2.4. Tissue and Blood Sample Collection

Before execution, we took blood samples from the mouse’s orbit. All samples were centrifuged at 1000 g for 20 min [23], and then, serum was obtained. All serum samples are stored at -80°C. On the 5th day after NEC induction (day 15 after birth), all mice were euthanized by cervical dislocation. After the abdominal incision, we removed the terminal ileum tissue from the mice. Part of the tissues was stored at -80°C for qRT-PCR and Western blot analysis. The remaining tissues were fixed with 4% paraformaldehyde, which were then embedded in paraffin. They were cut into 5 μm sections for H&E staining.

2.5. H&E Staining

The ileum tissue slices were subjected to dewaxing with xylol, which were then rehydrated with ethanol gradient. After rinsing, we utilized hematoxylin (G1004, Servicebio, China) to stain the slices. After differentiating, the slices were subjected to stain with 1% eosin solution (C0109, Beyotime, China). Then, the results were observed using an optical microscope (Z723975-1EA, Sigma, USA) after dehydrating and sealing. The histopathological score was estimated by two independent pathologists who were unaware of the study conditions based on the histopathological scoring system described by Gao et al. [24]. Grade 0 represents normal intestine; grade 1 represents separation of the Villous core; grade 2 shows epithelial cell abscission to the level of the middle villi; grade 3 indicates necrosis of the entire villi. Tissues with a histological score of ≥2 are considered to manifest NEC.

2.6. ELISA

Mouse TNF-α Kit (PT512) and mouse IL-1β Kit (PI301) were obtained from Beyotime (China). The prepared serum samples were added to the sample well and placed at room temperature for 120 min. After washing, each well was reacted with mouse IL-1β biotinylated antibody/TNF-α biotinylated antibody at 37°C for 1 h followed by reaction with HRP-labeled streptavidin at 37°C in the dark for 20 min. After reacting with TMB solution at 37°C away from light for 20 min, each well was then subjected to treatment with stop solution. Lastly, we utilized a microplate reader (CMaxPlus, MD, USA) to measure the absorbance (450 nm).

2.7. Detection of MDA, SOD, and GSH-Px

MDA kit (A003-1-2), SOD kit (A001-3-2), and GSH-Px kit (A005-1-2) were acquired from Jiancheng (China). The contents of MDA, SOD, and GSH-Px in the serum samples were assessed by the corresponding kit based on the manufacturer’s instruction.

2.8. Quantitative Real-Time PCR (qRT-PCR)

We utilized Total RNA Extractor (R1200, Solarbio, China) to extract RNA from the terminal ileum tissues. Subsequently, qRT-PCR reaction was carried out by using BeyoFast™ Probe One-Step qRT-PCR Kit (D7277M, Beyotime, China) under a PCR system (EDC-810, Eastwin Life Sciences, Inc.). GAPDH was taken as the normalization control. The primers were listed 5 to 3: NLRP3, (F) ATTACCCGCCCGAGAAAGG; (R) TCGCAGCAAAGATCCACACAG; TLR4, (F) AACCTGCTCTACCTACACCTG; (R) CCGAGAGATTGAGGAATCGAAG; NF-κB, (F) AAGATCCGTATGGCCCTCAAA; (R) TCCATCCTGGATACTGAAAGAGT; caspase-1, (F) TACTCCCACCGTTGAGCTGT; (R) CCGTAGCATCTGTGGATAGGC; and GAPDH, (F) TGACCTCAACTACATGGTCTACA; (R) CTTCCCATTCTCGGCCTTG. These gene expressions were counted by the method.

2.9. Western Blot

The harvested terminal ileum tissues were lysed via RIPA buffer (R0010, Solarbio, China). Next, we utilized the BCA kit (pc0020, Solarbio, China) to measure the concentrations of protein. The proteins were subjected to protein electrophoresis. Thereafter, the protein in the gel was shifted to a nitrocellulose membrane. After that, we utilized 5% nonfat milk to seal the membrane. The sealed membrane was washed and then exposed to primary antibodies all night at 4°C. The next day, the bound antibodies reacted with the anti-rabbit secondary antibody for 1.5 h at 37°C. After visualizing with the ECL reagent (abs920, Absin, China), the blots were placed in a ChemiScope 3300 Mini equipment (Clinx, China). The primary antibodies of anti-NLRP3 antibody (DF7438), anti-TLR4 antibody (AF7017), anti-NF-κB antibody (AF5006), anti-caspase-1 antibody (AF5418), and anti-GAPDH antibody (AF7021) were acquired from Affinity (USA).

2.10. Statistical Analysis

SPSS software (16.0, IBM, USA) was utilized to process data. Measurement data between multiple groups were tested for normal distribution using the Shapiro-Wilk test. One-way ANOVA analysis was employed for comparing the differences among multiple groups. Comparison between groups was assessed by the SNK test. The Kruskal-Wallis test was utilized to those with uneven variance. Data were expressed as . The statistical significance was defined as .

3. Results

3.1. MEL Intensified the Survival Rate and Body Weight of NEC Mice

We first established a NEC mouse model and monitored the death of mice during the experiment. As exhibited in Figure 1(a), no mice in the control group died during the experiment. The mice in the NEC group died on day 11, and the survival rate on day 14 was less than 50% (Figure 1(a), ). While after MEL intervention, the mortality of mice was greatly decreased, and the survival rate on day 14 was higher than 50% (Figure 1(a), ). The body weight of mice in the NEC group was lower than that of the control group on day 12 and day 14 after birth (Figure 1(b), ). More importantly, MEL notably improved the body weight of NEC mice born on day 12 and day 14 (Figure 1(b), ).

(a)

(b)

3.2. MEL Improved the Histopathological Injury in NEC Mice

In the next research, we utilized H&E staining to assess the histopathological injury in NEC mice. As displayed in Figure 2, in the control group, the intestinal tissue structure was clear and the intestinal epithelium was neatly arranged. In the NEC group, the integrity of the intestinal tissue was injured, the intestinal epithelium was broken and some of it was necrotic and exfoliated or disappeared, and the muscle layer became thinner or even broken (Figure 2). However, the intestinal tissue structure in the NEC+MEL group was obviously improved compared with that in the NEC group (Figure 2). Moreover, the semiquantitative score of H&E in the NEC group was higher than that in the control group (Figure 2). The H&E semiquantitative score of the NEC+MEL group was extremely lower than that of the NEC group (Figure 2). It was unveiled that MEL ameliorated the histopathological injury in NEC mice.

3.3. MEL Weakened the Inflammation and Oxidative Stress of Serum in NEC Mice

To check the role of MEL on inflammation- and oxidative stress-related markers of serum in NEC mice, we examined the contents of IL-1β, TNF-α, MDA, SOD, and GSH-Px. We discovered that the contents of IL-1β and TNF-α in NEC mice were largely augmented compared to the control mice, whereas MEL dramatically weakened the contents of IL-1β and TNF-α in NEC mice (Figures 3(a) and 3(b), ). Moreover, the contents of SOD and GSH-Px were attenuated and the content of MDA was intensified in NEC mice (Figures 4(a)–4(c), ). MEL notably boosted the contents of SOD and GSH-Px while it restrained the content of MDA in NEC mice (Figures 4(a)–4(c), ).

(a)

(b)

(a)

(b)

(c)

3.4. MEL Attenuated the NLRP3, TLR4, NF-κB, and Caspase-1 of the Terminal Ileum Tissues in NEC Mice

The inflammatory TLR4/NLRP3 pathway-related markers were further detected by qRT-PCR and Western blot. The qRT-PCR assay manifested that the mRNA levels of NLRP3, TLR4, NF-κB, and caspase-1 of the terminal ileum tissues in NEC mice were prominently upregulated, while the elevated effects were partially offset by MEL treatment (Figures 5(a)–5(d), ). We further utilized Western blot to examine the TLR4/NLRP3 pathway-related factors. The results of Western blot were consistent with qRT-PCR (Figures 6(a)–6(e), ).

(a)

(b)

(c)

(d)

(a)

(b)

(c)

(d)

(e)

4. Discussion

In this work, the experimental NEC model was established in ten-day-old C57BL/6 mice by formula milk with LPS and hypoxia [21]. H&E staining results clarified that in the NEC group, the integrity of the intestinal tissue was lost, the intestinal epithelium was broken and some of it was necrotic and exfoliated or disappeared, and the muscle layer became thinner or even broken, illuminating that the mouse model of NEC was established successfully. More importantly, MEL improved the histopathological injury in NEC mice.

At present, epidemiology suggests that NEC is considered to be related to factors such as premature birth, intestinal mucosal hypoxia-ischemia, infection, and formula feeding [25]. The incidence of NEC in formula-fed newborns was notably higher than that in breast-fed newborns [26]. A study discovered that formula feeding within 10 days after birth evidently boosted the risk of NEC in infants, while breastfeeding did the opposite [27]. These studies demonstrated that formula facilitated the development of NEC, while breast milk has a certain preventive effect on NEC. In our study, we observed that there was no death in the breast-fed control mice, while NEC model rats had an obvious increase in mortality and a notable decrease in body weight after modeling. Interestingly, MEL intensified the survival rate and body weight in NEC mice, which was consistent with the results of Guven et al. [22].

Although it is not yet distinct which factors play a leading role in NEC, the theory that inflammatory factors participate in intestinal injury of NEC has gradually been recognized [28]. The proinflammatory pathway mediated by TLR4 is a crucial link in the pathogenesis of neonatal NEC, and inhibition of the TLR4-mediated inflammatory pathway may be a new therapy for the prevention and therapy of neonatal NEC [29, 30]. The key link between TLR4 overexpression and apparent inflammatory disease may be the production of downstream IL-1β [31]. IL-1β can induce intestinal inflammation and generate a modulation in epithelial healing and repair by recruiting and activating immune cells to further induce the generation of chemokines, proinflammatory cytokines, and growth factors [32]. The maturation and secretion of IL-1β are highly controlled by the activation of NLRP3 induced by TLR4/NF-κB to prevent inappropriate inflammation [33, 34]. The NLRP3 inflammasome could activate caspase-1, mediate the maturation and secretion of IL-1β and IL-18, and further recruit and activate other immune cells to enhance local and systemic inflammatory responses [35]. In addition, it was confirmed that TNF-α induces intestinal mucosal damage by activating the inflammatory cascade, advancing the release of itself and other inflammatory factors [36].

A previous study claimed that MEL alleviated trinitrobenzene sulfonic acid-triggered colitis in rats via restraining the TLR4/NF-κB pathway [37]. Yang et al. illustrated that MEL ameliorated intestinal damage, inflammation, and cognitive dysfunction induced by intestinal ischemia/reperfusion (I/R) through weakening the TLR4/Myd88 pathway [38]. Another research illuminated that MEL protected rats from small intestinal toxicity caused by radiotherapy through restraining the NF-κB/NLRP3 pathway [39]. In this research, we discovered that MEL could decrease the TNF-α and IL-1β activities of the terminal ileum tissues in NEC mice. The further research demonstrated that the mRNA and protein levels of NLRP3, TLR4, NF-κB, and caspase-1 of the terminal ileum tissues in NEC mice were largely intensified, whereas MEL blocked these changes. It was illuminated that MEL may blunt the level of intestinal tissue inflammation by repressing the expression of the NLRP3 inflammasome and TLR4 signaling, to further suppress the inflammatory factor production, thereby alleviating the inflammatory injury of intestinal tissue in NEC neonatal mice.

Karadag et al. discovered that increased inflammatory cytokines in NEC were also mainly caused by intestinal oxidative stress [40]. It was illuminated in another study that abnormal colonization of intestinal flora induced the increase in intestinal oxidative stress to damage the intestinal mucosal barrier, lead to bacterial translocation, and activate the immune system, which in turn triggered the NEC intestinal inflammation [29]. Premature infants with immature intestinal mucosal barrier function are prone to intestinal hypoxia, ischemia, abnormal colonization of flora, etc., and produce a large amount of oxygen free radicals to activate intestinal oxidative stress, resulting in protein, DNA, and cell membrane peroxidation [41]. Excessive free radicals can mediate the production of abundant MDA, resulting in tissue cell damage [42]. The first line of defense of the body’s antioxidant system is responsible for inhibiting the generation of excess oxygen free radicals and lipid peroxidation. The defense of cells against oxidative stress is mediated by SOD and GSH [43]. SOD and GSH can neutralize oxygen free radicals to resist oxidative stress [44, 45]. Musa et al. pointed out that MEL evidently alleviated MDA level and enhanced SOD level of the irradiated intestinal tissues, thereby ameliorating radiotherapy-triggered intestinal injury [46]. One research by Cigsar et al. clarified that MDA activity was weakened, and SOD and GSH-Px levels were enhanced in NEC rats [47]; our results were consistent with Cigsar et al. Interestingly, MEL notably boosted the contents of SOD and GSH-Px and restrained the content of MDA in NEC mice.

5. Conclusion

In summary, this study illuminated that MEL could alleviate intestinal inflammatory response and protect intestinal injury of NEC by mitigating intestinal oxidative stress, increasing its antioxidant capacity, and weakening the NLRP3 inflammasome, which may offer a novel idea for the prevention and therapy of NEC.

Data Availability

All data generated or analyzed during this study are included in this article.

Conflicts of Interest

The authors declare that they have no competing interests.

Authors’ Contributions

JJ Zhu conceived the idea of the manuscript. XY Xiong drafted the manuscript and plotted the figures and tables. ZK Bao searched and analyzed the literature. Yh Mi and XH Wang conducted the experiments. XY Xiong and ZK Bao wrote the manuscript. All authors read and approved the final manuscript.

Acknowledgments

This study was supported by the Major Science and Technology of the National Health Commission and Zhejiang Province, China (grant number WKJ-ZJ-2032). This study was supported by the Public Project of Technology Research and Social Development in Zhejiang Province, China (grant number LGF20H180014).

References

D. F. Niño, C. P. Sodhi, and D. J. Hackam, “Necrotizing enterocolitis: new insights into pathogenesis and mechanisms,” Nature reviews Gastroenterology & hepatology, vol. 13, no. 10, pp. 590–600, 2016.
View at: Publisher Site | Google Scholar
F. Esposito, R. Mamone, M. Di Serafino et al., “Diagnostic imaging features of necrotizing enterocolitis: a narrative review,” Quantitative imaging in medicine and surgery, vol. 7, no. 3, pp. 336–344, 2017.
View at: Publisher Site | Google Scholar
R. Sharma and M. L. Hudak, “A clinical perspective of necrotizing enterocolitis: past, present, and future,” Clinics in Perinatology, vol. 40, no. 1, pp. 27–51, 2013.
View at: Publisher Site | Google Scholar
K. Wang, G. Tao, and K. G. Sylvester, “Recent advances in prevention and therapies for clinical or experimental necrotizing enterocolitis,” Digestive diseases and sciences, vol. 64, no. 11, pp. 3078–3085, 2019.
View at: Publisher Site | Google Scholar
J. Neu and W. A. Walker, “Necrotizing enterocolitis,” The New England journal of medicine, vol. 364, no. 3, pp. 255–264, 2011.
View at: Publisher Site | Google Scholar
J. R. Robinson, E. J. Rellinger, L. D. Hatch et al., “Surgical necrotizing enterocolitis,” Seminars in perinatology, vol. 41, no. 1, pp. 70–79, 2017.
View at: Publisher Site | Google Scholar
R. M. Patel and M. A. Underwood, “Probiotics and necrotizing enterocolitis,” Seminars in pediatric surgery, vol. 27, no. 1, pp. 39–46, 2018.
View at: Publisher Site | Google Scholar
D. Torres, T. Muñoz, A. Bancalari, and C. Manríquez, “Prolonged initial empirical antibiotic treatment and the risk of morbidity and mortality in very low birthweight infants,” Revista chilena de pediatria, vol. 89, no. 5, pp. 600–605, 2018.
View at: Publisher Site | Google Scholar
B. D. Carr and S. K. Gadepalli, “Does surgical management alter outcome in necrotizing enterocolitis?” Clinics in Perinatology, vol. 46, no. 1, pp. 89–100, 2019.
View at: Publisher Site | Google Scholar
Y. Jing, F. Peng, Y. Shan, and J. Jiang, “Berberine reduces the occurrence of neonatal necrotizing enterocolitis by reducing the inflammatory response,” Experimental and therapeutic medicine, vol. 16, no. 6, pp. 5280–5285, 2018.
View at: Publisher Site | Google Scholar
Z. Li and L. Sheng, “Significance of dynamic evolution of TNF-α, IL-6 and intestinal fatty acid-binding protein levels in neonatal necrotizing enterocolitis,” Experimental and therapeutic medicine, vol. 15, no. 2, pp. 1289–1292, 2018.
View at: Publisher Site | Google Scholar
A. Zahid, B. Li, A. J. K. Kombe, T. Jin, and J. Tao, “Pharmacological inhibitors of the NLRP3 inflammasome,” Frontiers in immunology, vol. 10, p. 2538, 2019.
View at: Publisher Site | Google Scholar
Y. Huang, Y. Peng, J. Sun et al., “Nicotinamide phosphoribosyl transferase controls NLRP3 inflammasome activity through MAPK and NF-κB signaling in nucleus pulposus cells, as suppressed by melatonin,” Inflammation, vol. 43, no. 3, pp. 796–809, 2020.
View at: Publisher Site | Google Scholar
Y. Yin, J. Wang, X. Zhao et al., “Overexpressed FOXO3 improves inflammatory status in mice by affecting NLRP3-mediated cell coronation in necrotizing colitis mice,” Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, vol. 125, article 109867, 2020.
View at: Publisher Site | Google Scholar
R. X. Li, J. Li, S. Y. Zhang, Y. L. Mi, and C. Q. Zhang, “Attenuating effect of melatonin on lipopolysaccharide-induced chicken small intestine inflammation,” Poultry science, vol. 97, no. 7, pp. 2295–2302, 2018.
View at: Publisher Site | Google Scholar
K. Wang, J. Ru, H. Zhang et al., “Melatonin enhances the therapeutic effect of plasma exosomes against cerebral ischemia-induced pyroptosis through the TLR4/NF-κB pathway,” Frontiers in Neuroscience, vol. 14, p. 848, 2020.
View at: Publisher Site | Google Scholar
B. Sun, S. Yang, S. Li, and C. Hang, “Melatonin upregulates nuclear factor erythroid-2 related factor 2 (Nrf 2) and mediates mitophagy to protect against early brain injury after subarachnoid hemorrhage,” Medical science monitor: international medical journal of experimental and clinical research, vol. 24, article 909221, pp. 6422–6430, 2018.
View at: Publisher Site | Google Scholar
H. R. Berger, A. K. G. Nyman, T. S. Morken, and M. Widerøe, “Transient effect of melatonin treatment after neonatal hypoxic-ischemic brain injury in rats,” PloS one., vol. 14, no. 12, article e0225788, 2019.
View at: Publisher Site | Google Scholar
S. Ma, J. Chen, J. Feng et al., “Melatonin ameliorates the progression of atherosclerosis via mitophagy activation and NLRP3 inflammasome inhibition,” Oxidative medicine and cellular longevity, vol. 2018, Article ID 9286458, 12 pages, 2018.
View at: Publisher Site | Google Scholar
Y. Zhang, X. Li, J. J. Grailer et al., “Melatonin alleviates acute lung injury through inhibiting the NLRP3 inflammasome,” Journal of pineal research, vol. 60, no. 4, pp. 405–414, 2016.
View at: Publisher Site | Google Scholar
F. Ma, H. Hao, X. Gao et al., “Melatonin ameliorates necrotizing enterocolitis by preventing Th17/Treg imbalance through activation of the AMPK/SIRT1 pathway,” Theranostics, vol. 10, no. 17, pp. 7730–7746, 2020.
View at: Publisher Site | Google Scholar
A. Guven, B. Uysal, G. Gundogdu, E. Oztas, H. Ozturk, and A. Korkmaz, “Melatonin ameliorates necrotizing enterocolitis in a neonatal rat model,” Journal of pediatric surgery, vol. 46, no. 11, pp. 2101–2107, 2011.
View at: Publisher Site | Google Scholar
I. Kramerova, E. Kudryashova, B. Wu et al., “Mitochondrial abnormalities, energy deficit and oxidative stress are features of calpain 3 deficiency in skeletal muscle,” Human Molecular Genetics, vol. 18, no. 17, pp. 3194–3205, 2009.
View at: Publisher Site | Google Scholar
X. Gao, W. Liu, P. Gao, S. Li, Z. Chen, and F. Ma, “Melatonin-induced lncRNA LINC01512 prevents Treg/Th17 imbalance by promoting SIRT1 expression in necrotizing enterocolitis,” International Immunopharmacology, vol. 96, article 107787, 2021.
View at: Publisher Site | Google Scholar
M. Thyoka, P. de Coppi, S. Eaton et al., “Advanced necrotizing enterocolitis part 1: mortality,” Zeitschrift für Kinderchirurgie, vol. 22, no. 1, pp. 8–12, 2012.
View at: Publisher Site | Google Scholar
K. Herrmann and K. Carroll, “An exclusively human milk diet reduces necrotizing enterocolitis,” Breastfeeding medicine: the official journal of the Academy of Breastfeeding Medicine, vol. 9, no. 4, pp. 184–190, 2014.
View at: Publisher Site | Google Scholar
W. E. Corpeleijn, S. M. Kouwenhoven, M. C. Paap et al., “Intake of own mother's milk during the first days of life is associated with decreased morbidity and mortality in very low birth weight infants during the first 60 days of life,” Neonatology, vol. 102, no. 4, pp. 276–281, 2012.
View at: Publisher Site | Google Scholar
C. J. Hunter and I. G. De Plaen, “Inflammatory signaling in NEC: role of NF-κB, cytokines and other inflammatory mediators,” Pathophysiology: the official journal of the International Society for Pathophysiology, vol. 21, no. 1, pp. 55–65, 2014.
View at: Publisher Site | Google Scholar
X. Li, X. Li, Q. Shang et al., “Fecal microbiota transplantation (FMT) could reverse the severity of experimental necrotizing enterocolitis (NEC) via oxidative stress modulation,” Free radical biology & medicine, vol. 108, pp. 32–43, 2017.
View at: Publisher Site | Google Scholar
Y. Hou, X. Lu, and Y. Zhang, “IRAK inhibitor protects the intestinal tract of necrotizing enterocolitis by inhibiting the toll-like receptor (TLR) inflammatory signaling pathway in rats,” Medical science monitor: international medical journal of experimental and clinical research, vol. 24, pp. 3366–3373, 2018.
View at: Publisher Site | Google Scholar
Y. Liu, Y. Dai, Q. Li et al., “Beta-amyloid activates NLRP3 inflammasome via TLR4 in mouse microglia,” Neuroscience Letters, vol. 736, article 135279, 2020.
View at: Publisher Site | Google Scholar
G. Mannino, F. Caradonna, I. Cruciata, A. Lauria, A. Perrone, and C. Gentile, “Melatonin reduces inflammatory response in human intestinal epithelial cells stimulated by interleukin-1β,” Journal of pineal research, vol. 67, no. 3, article e12598, 2019.
View at: Publisher Site | Google Scholar
R. Yu, S. Jiang, Y. Tao, P. Li, J. Yin, and Q. Zhou, “Inhibition of HMGB1 improves necrotizing enterocolitis by inhibiting NLRP3 via TLR4 and NF-κB signaling pathways,” Journal of cellular physiology, vol. 234, no. 8, pp. 13431–13438, 2019.
View at: Publisher Site | Google Scholar
Y. Bai, Z. Li, W. Liu, D. Gao, M. Liu, and P. Zhang, “Biochanin A attenuates myocardial ischemia/reperfusion injury through the TLR4/NF-κB/NLRP3 signaling pathway,” Acta cirurgica brasileira, vol. 34, no. 11, article e201901104, 2019.
View at: Publisher Site | Google Scholar
J. W. Koo and R. S. Duman, “IL-1beta is an essential mediator of the antineurogenic and anhedonic effects of stress,” Proceedings of the National Academy of Sciences of the United States of America, vol. 105, no. 2, pp. 751–756, 2008.
View at: Publisher Site | Google Scholar
C. Tayman, S. Aydemir, I. Yakut et al., “TNF-α blockade efficiently reduced severe intestinal damage in necrotizing enterocolitis,” Journal of investigative surgery: the official journal of the Academy of Surgical Research, vol. 29, no. 4, pp. 209–217, 2016.
View at: Publisher Site | Google Scholar
M. Chamanara, A. Rashidian, S. E. Mehr et al., “Melatonin ameliorates TNBS-induced colitis in rats through the melatonin receptors: involvement of TLR4/MyD88/NF-κB signalling pathway,” Inflammopharmacology, vol. 27, no. 2, pp. 361–371, 2019.
View at: Publisher Site | Google Scholar
B. Yang, L. Y. Zhang, Y. Chen et al., “Melatonin alleviates intestinal injury, neuroinflammation and cognitive dysfunction caused by intestinal ischemia/reperfusion,” International Immunopharmacology, vol. 85, article 106596, 2020.
View at: Publisher Site | Google Scholar
B. Fernández-Gil, A. E. Moneim, F. Ortiz et al., “Melatonin protects rats from radiotherapy-induced small intestine toxicity,” PloS one, vol. 12, no. 4, article e0174474, 2017.
View at: Publisher Site | Google Scholar
A. Karadag, R. Ozdemir, A. Kurt et al., “Protective effects of dexpanthenol in an experimental model of necrotizing enterocolitis,” Journal of pediatric surgery, vol. 50, no. 7, pp. 1119–1124, 2015.
View at: Publisher Site | Google Scholar
Z. Cai, J. Liu, H. Bian, and J. Cai, “Astragaloside IV ameliorates necrotizing enterocolitis by attenuating oxidative stress and suppressing inflammation via the vitamin D3-upregulated protein 1/NF-κB signaling pathway,” Experimental and therapeutic medicine, vol. 12, no. 4, pp. 2702–2708, 2016.
View at: Google Scholar
S. Yazıcı, C. U. Ozcan, A. A. Hismiogullari et al., “Protective effects of quercetin on necrotizing enterocolitis in a neonatal rat model,” American journal of perinatology, vol. 35, no. 5, pp. 434–440, 2018.
View at: Publisher Site | Google Scholar
U. Cakir, C. Tayman, U. Serkant et al., “Ginger (Zingiber officinale Roscoe) for the treatment and prevention of necrotizing enterocolitis,” Journal of Ethnopharmacology, vol. 225, pp. 297–308, 2018.
View at: Publisher Site | Google Scholar
G. Ganguli, U. Mukherjee, and A. Sonawane, “Peroxisomes and oxidative stress: their implications in the modulation of cellular immunity during mycobacterial infection,” Frontiers in microbiology, vol. 10, p. 1121, 2019.
View at: Publisher Site | Google Scholar
S. G. Lee, J. Yim, Y. Lim, and J. H. Kim, “Validation of a liquid chromatography tandem mass spectrometry method to measure oxidized and reduced forms of glutathione in whole blood and verification in a mouse model as an indicator of oxidative stress,” Journal of chromatography B, Analytical technologies in the biomedical and life sciences, vol. 1019, pp. 45–50, 2016.
View at: Publisher Site | Google Scholar
A. E. Musa, D. Shabeeb, and H. S. Q. Alhilfi, “Protective Effect of Melatonin against Radiotherapy-Induced Small Intestinal Oxidative Stress: Biochemical Evaluation,” Medicina (Kaunas, Lithuania), vol. 55, no. 6, p. 308, 2019.
View at: Publisher Site | Google Scholar
E. B. Cigsar, C. A. Karadag, C. Tanik, A. F. Aydin, and A. I. Dokucu, “The protective effects of sesamol in a neonatal rat model of necrotizing enterocolitis,” The journal of maternal-fetal & neonatal medicine: the official journal of the European Association of Perinatal Medicine, the Federation of Asia and Oceania Perinatal Societies, the International Society of Perinatal Obstet, vol. 33, no. 6, pp. 889–894, 2020.
View at: Publisher Site | Google Scholar

Copyright

Copyright © 2022 Xiaoyu Xiong et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PDF Download Citation

Download other formats

Order printed copies

Views

347

Downloads

655

Citations