Evidence-Based Complementary and Alternative Medicine / 2014 / Article / Tab 2

Research Article

Olive Leaf Extract Attenuates Obesity in High-Fat Diet-Fed Mice by Modulating the Expression of Molecules Involved in Adipogenesis and Thermogenesis

Table 2

Primer sequences and RT-PCR conditions.

Gene descriptionPrimersSequences (5′→3′) (°C)Size (bp)

Peroxisome proliferator-activated receptor (PPAR )FTTCGGAATCAGCTCTGTGGA55148
RCCATTGGGTCAGCTCTTGTG
CCAAT/enhancer binding-protein α (C/EBP )FAAGGCCAAGAAGTCGGTGGA55189
RCCATAGTGGAAGCCTGATGC
LeptinFCTCCAAGGTTGTCCAGGGTT55143
RAAAACTCCCCACAGAATGGG
Cluster of differentiation 36 (CD36)FATGACGTGGCAAAGAACAGC55160
RGAAGGCTCAAAGATGCCTCC
Fatty acid synthase (FAS)FTTGCCCGAGTCAGAGAACC55171
RCGTCCACAATAGCTTCATAGC
Wingless-type MMTV integration site family, member 10b (WNT10b)FTTTTGGCCACTCCTCTTCCT61183
RTCCTTTTCCAACCGAAAACC
Secreted frizzled-related protein 5 (SFRP5)FCTGATGGCCTCATGGAACAG55155
RCTTGGTGTCCTTGCGCTTTA
GalaninFGAGCCTTGATCCTGCACTGA60121
RAGTGGCTGACAGGGTCACAA
Galanin receptor 1 (GalR1)FCCAAGGGGGTATCCCAGTAA55147
RGGCCAAACACTACCAGCGTA
Galanin receptor 2 (GalR2)FATAGTGGTGCTCATGCTGGAA60134
RAGGCTGGATCGAGGGTTCTA
Protein kinase C (PKC )FCTGAGCGCTGCAAGAAGAAC60146
RTGGAAACTTTGATCCTGCACTGA
Peroxisome proliferative activated receptor γ coactivator 1 (PGC-1 )FTAAATCTGCGGGATGATGGA55117
RGTTTCGTTCGACCTGCGTAA
Uncoupling protein 1 (UCP1)FGGTTTTGCACCACACTCCTG55111
RACATGGACATCGCACAGCTT
Cyclin D (cyc-D)FTGGGAAGTTTTGTTGGGTCA55144
RTCCTTGTCCAGGTAATGCCA
E2F1FCCTGGAGCATGTTAAAGAAG55102
RCCTCGAGACCAAAGTGATAG
Sirtuin 1 (SIRT1)FAGCTCCTTGGAGACTGCGAT55182
RATGAAGAGGTGTTGGTGGCA
Cytochrome C oxidase subunit 2 (COX2)FCCGAGTCGTTCTGCCAATAG55159
RAACCCTGGTCGGTTTGATGT
Mitochondrial transcription factor A (TFAM)FAGTGTGGCAGTCCATAGGCA55123
RCAGTGCTTTTAGCACGCTCC
Nuclear respiratory factor-1 (NRF-1)FTTTCATGGACCCAGGCATTA55119
RTGGTGGCCTGAGTTTGTGTT
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)FAGAACATCATCCCTGCATCC55321
RTCCACCACCCTGTTGCTGTA

You are browsing a BETA version of Hindawi.com. Click here to switch back to the original design.