BioMed Research International / 2011 / Article / Tab 3

Research Article

Construction of Papaya Male and Female BAC Libraries and Application in Physical Mapping of the Sex Chromosomes

Table 3

Primers used in designing probes to screen the BAC libraries and fill the gaps of the HSY and X physical maps.

BAC IDForward primer sequenceReverse primer sequence

SH89M06ATGCAAGCTTCCCCTATCAAAGCCACAAGGGAGTGAAAGA
SH93H03TCCATGCAGTAAACGCACTCTGGTCACACCGTTAGGCAAC
SH96A24AATTGATTGGTTGGCAGCATCGCCATTCGATACAGAACCT
SH61K24TTATTTCAAACAAGGGTTCTTTTTTTGGCAAACCTGAGAAAAC
DM125I09GTCCGGTATGAGGGTGAAACCTTACTGGACGGGGTTGG
SH54M13CCCTACTGGGGTCACATCATTGCCCTGCTGAATCTTTAGG
SH49N10TGGCCCATCATTAGTTCACCATCCCCTTGAGAAGCCCTAA

You are browsing a BETA version of Hindawi.com. Click here to switch back to the original design.