Antiretroviral (ARV) Drug Resistance and HIV-1 Subtypes among Injecting Drug Users in the Coastal Region of Kenya

Ng’ong’a, Gabriel O.; Ayodo, George; Kawaka, Fanuel; Knight, Veronicah; Ngayo, Musa; Lwembe, Raphael M.

doi:https://doi.org/10.1155/2022/3217749

Advances in Virology

On this page

Abstract Introduction Methods Results Discussion Conclusion Data Availability Ethical Approval Consent Conflicts of Interest Acknowledgments References Copyright Related Articles

Research Article | Open Access

Volume 2022 | Article ID 3217749 | https://doi.org/10.1155/2022/3217749

Antiretroviral (ARV) Drug Resistance and HIV-1 Subtypes among Injecting Drug Users in the Coastal Region of Kenya

Gabriel O. Ng’ong’a,¹George Ayodo,^1,2Fanuel Kawaka ,³Veronicah Knight,²Musa Ngayo,²and Raphael M. Lwembe²

Academic Editor: Shih-Chao Lin

Received25 Nov 2021

Accepted18 Jan 2022

Published10 Feb 2022

Abstract

HIV-1 genetic diversity results into the development of widespread drug-resistant mutations (DRMs) for the first-line retroviral therapy. Nevertheless, few studies have investigated the relationship between DRMs and HIV-1 subtypes among HIV-positive injecting drug users (IDUs). This study therefore determined the association between HIV-1 genotypes and DRMs among the 200 IDUs. Stanford HIV Drug Resistance Database was used to interpret DRMs. The five HIV-1 genotypes circulating among the IDUs were A₁ (25 (53.2%)), A₂ (2 (4.3%)), B (2 (4.3%)), C (9 (19.1%)), and D (9 (19.1%)). The proportions of DRMs were A₁ (12 (52.2%)), A₂ (1 (4.3%)), B (0 (0.0%)), C (5 (21.7%)), and D (5 (21.7%)). Due to the large proportion of drug resistance across all HIV-1 subtypes, surveillance and behavioral studies need to be explored as IDUs may be spreading the drug resistance to the general population. In addition, further characterization of DRMs including all the relevant clinical parameters among the larger population of IDUs is critical for effective drug resistance surveillance.

1. Introduction

The introduction of highly active antiretroviral therapy (HAART) in 1996 has resulted in improved treatment outcome and survival rate in human immunodeficiency virus-1 (HIV-1) infected patients [1–3]. The success of these drug regimens is being challenged by the emergence of drug-resistant mutations [1]. Indeed, transmitted drug resistance generally leads to a delay in virologic suppression [4, 5] and results in an increased risk of treatment failure [6]. Drug resistance testing and monitoring of HIV subtypes can improve treatment outcomes in infected individuals [7, 8]. However, limited studies have been done on the high-risk group such as injecting drug users (IDUs). These mutant variants have become increasingly widespread, in drug-treated and untreated individuals infected with HIV, and have compromised the therapeutic options of drug-naïve infected people [6, 9].

Studies in Kenya have reported the occurrence of HIV drug resistance upon ART failure in Mombasa [10], Mombasa and Nairobi as part of a multisite African study [11], and Burnt Forest, a rural Academic Model Providing Access to Healthcare (AMPATH) clinic [12]. HIV-1 infection is highly diverse with the circulation of subtypes A (50–80%), D (10–20%), and C (5–15%) and multiple recombinants (10–20%) [13, 14]. Extensive genetic heterogeneity is driven by several factors, such as the lack of proofreading ability of the reverse transcriptase (RT) [15], the rapid turnover of HIV-1 in vivo [16], host-selective immune pressures [17], leading to drug resistance selection pressure, and recombination events during replication [18]. HIV type 1 is divided into groups M, N, O, and P, more than 90% of HIV infections are derived from HIV-1 group M, and the rest are minor groups [19, 20]. The M group is subdivided further into clades, called subtypes, which are also given letters ranging from A to K. Subtype A has been subdivided into A₁, A₂, A₃, A₄, A₅, and A₆, while subtype F has been subdivided into F₁ and F₂ [21]. This study therefore assessed the relationship between HIV-1-circulating genotypes and drug-resistant mutations among IDUs.

2. Methods

2.1. Study Setting

A cross-sectional survey was conducted among HIV-positive injecting drug users in Malindi Sub-County, coastal region of Kenya. The study enrolled 200 IDUs who consented and fulfilled eligibility criteria of being HIV infected, 18 years old and above, actively injecting drugs for the past six months, and were able to respond to structured questionnaires during interviews.

2.2. Participant Recruitment and Administration of Questionnaires

Snowball sampling was adopted since IDUs are hard to reach the population. A set of initial participants referred to as “seed” for an expanding chain of referrals. All the participants were provided with written informed consent, and only those who consented were recruited into the study. Each participant was assigned a confidential identification number. The reliability of the questionnaire was pretested on 20 respondents (10%) and revised based on their feedbacks. The structured questionnaires were then administered by a qualified counselor in a private room using face-to-face interviews for approximately 10 minutes. Sociodemographic information was also collected during the interviews.

2.3. Ethical Consideration

This study sought ethical approval from the Scientific Ethical Review Unit (SERU)—KEMRI (SSC no. 1438). Furthermore, permission was also sought from Jaramogi Oginga Odinga University of Science and Technology (JOOUST). Voluntary and written informed consent was obtained from the study participant before being allowed to take part in this study. Furthermore, the data collected from this study were confidential and only used for the purpose explained in the consent forms. Participation in this study presented no life-threatening risks.

2.4. Sample Collection

Blood samples were collected from HIV-positive IDUs with and without prior exposure to first-line antiretroviral therapy for HIV-1 subtypes and drug-resistant mutation analysis. About 5 ml of whole blood was drawn from each participant, separated into plasma, and transported to Kenya Medical Research Institute (KEMRI) under the cold chain for serological HIV-1 testing and molecular analysis. HIV colloidal gold, a rapid test for antibody to HIV, was used according to guidelines by the Ministry of Health for adult HIV testing [22, 23]. Whole blood was spun at 3,000 rpm for 3 minutes, and plasma aspirated aseptically and stored at −80°C for subsequent RNA extraction.

2.5. RNA Extraction and Genotyping

RNA was extracted from 140 µl of plasma using a QIAmp viral RNA kit according to the manufacturer’s instructions (Qiagen Inc., USA). A nested polymerase chain reaction (PCR) was performed using AmpliTaq Gold (Roche Molecular Systems, Branchburg, NJ) [24]. PCR products of correct size were confirmed by agarose gel electrophoresis, purified, and sequenced by dideoxynucleoside-based analysis using a BigDye terminator kit (Applied Biosystems) and ABI Prism 3100 equipment (Applied Biosystems, Foster City, US) [25].

2.6. Drug-Resistant Mutation Analysis

HIV drug resistance was defined as the presence of HIV mutations associated with impaired drug susceptibility. A nested PCR was performed using AmpliTaq Gold (Roche Molecular Systems, Branchburg, NJ) in the first round; HIV-1 pol gene was amplified using primers (RT18: 5′ GGAAACCAAAAATGATAGGGGGAATTGGAGG3′) and master mix consisting of 5 μl H₂O, 12.5 μl 2X reaction mix, 1 μl primer RT18, 1 μl primer RT21, 1 μl Platinum Taq, and 5 μl RNA template and RT21 (5′ CTGTATTTCTGCTATTAAGTCTTTTGATGGG 3′). The second-round amplification includes primers (RT1: 5′CCAAAAGTTAAATGGCCATTGACAGA3′ and RT4: 5′AGTTCATAACCCATCCAAAG 3′) and master mix consisting of 27.7 μl H₂O, 5 μl 10 × buffer, 5 μl 25 mM MgCl₂, 5 μl dNTP 8 mM, 2.5 μl primer RT1, 2.5 μl primer RT4, 0.3 μl Taq, and 2 μl 1st round template. The PCR amplification was confirmed by visualization with ethidium bromide staining of agarose gel. The PCR-positive samples were cleaned off excess primers and nucleotides in a single step using ExoSAP-IT^™ PCR technology according to manufacturer’s instructions. Sequencing was achieved by dideoxynucleoside-based analysis using a BigDye terminator kit (Applied Biosystems) and ABI Prism 3300 equipment (Applied Biosystems, Foster City, US). Generated nucleotide sequences were edited using Sequencher^® 5.4.1 user 2015, Gene Codes Corporation Inc.

The identification and interpretation of drug-resistant mutations were done using the Stanford University and International AIDS Society, USA (http://hivdb.stanford.edu).

2.7. Statistical Methods

Chi-square (χ²) tests were done to establish the relationship between HIV-1 subtypes and drug resistance using Stata software version 13.0. Statistical significance was established at the 95% confidence limit within a marginal error of 0.05. Demographic data were analyzed using descriptive statistics; frequency (n) and percentage occurrence (%) of variables were generated using cross-tabulations.

3. Results

3.1. Sociodemographic Characteristics of Study Participants

This study involved 200 injecting drug users with 120 (60%) males and 80 (40%) females. 55% (n = 111) of the study participants were born in Malindi, 38% (n = 76) were from Kilifi, while 99% (n = 198) of the study participants were self-employed. A high proportion of this study population was unmarried (70.5%, n = 141), and 85% (n = 171) had a primary level of education. 70.5% (n = 141) were single with only 23.5% married (n = 47); the rest were divorcees (6.0%, n = 12) (Table 1).

The mean age of the study population was 33.36 years with a range of 19 to 82 years. Out of the extracted 200 RNA samples, 79 DNA samples were amplified, and 47 samples were successfully sequenced. The drug-resistant mutations were observed on 23 out of the 47 samples (48.9%).

3.2. HIV-1 Genotypes Circulating among the IDUs

As shown in Figure 1, a total of 5 HIV-1 subtypes, namely, A₁, A₂, B, C, and D, were observed. The HIV-1 subtype A₁ was the most abundant (25 (53.2%)). Both subtypes C and D had a similar frequency of 19.1% compared to A₂ and B in which both were 4.3%.

3.3. Drug-Resistant Mutations (DRMs) among Different HIV-1 Subtypes

Of the 47 study participants, 23 (48.9%) had the drug resistance as shown in Table 2. HIV-1 subtype A₁ had the highest proportion of drug-resistant mutations (52.2%, n = 12), followed by both C and D which had 5 (21.7%) mutations. However, there was no significant association between the HIV-1 genotype and drug-resistant mutations (χ² = 2.9752; = 0.704). Other HIV-1 subtypes such as A₂ and B had very low frequency of drug-resistant mutations.

E138A mutant genes had a high frequency of occurrence (3 times) in both NRTIs and NNRTIs. However, K103N mutations were more implicated in NNRTIs (4 times) than in NRTIs (once), while the individuals taking NNRTIs had also high chances of developing K103N, K219KN, and Y181C mutations (Table 3).

All the NRTIs exhibited the following mutations: M41ML, D67N, K70R, M184V, K219Q, V106A, L74LV, Y181YC, G190GA, K70KN, K70R, V75VI, M184LV, and K219HQ. It was also observed that all the NNRTIs manifested A98G, V179T, V106I, V179IL, and G190AS mutations (Table 4). These results further showed that HIV-1 subtype B exhibited no drug-resistant mutation.

It was observed that 34.8% (n = 8) of the 23 samples that exhibited major resistant mutations were ART-naïve individuals; they were drug-resistant de novo IDUs. These individuals were still on Septrin at the time of sample collection. Among the drug-naïve participants, it was established that HIV-1 subtype A₁ exhibited most of mutant genes affecting both NRTIs (K70KN, D67N, K70R, V75VI, M184LV, K219HQ, Y115YF, K65KE, and L74LW) and NNRTs (V106VI, V179IL, and G190AS). NTRIs were observed to be the most resisted group of ART in this study. Subtype B had no mutant gene among the drug-naïve IDUs (Table 5).

Among ART-experienced IDUs, this study established 65.2% (n = 15) samples that showed major resistant mutations. It was revealed that those who had been on ART between 1 and 5 years had more mutations than those less than one year and also above five years. It was also observed that HIV-1 subtype A₁ had the most abundant drug-resistant mutations. Mutant gene E138A was commonly observed in subtype C (Table 6).

4. Discussion

The study shows five HIV-1 genotypes circulating with the high proportion of drug-resistant mutations observed in HIV-1-A₁ subtype among the IDUs. As much as our study shows a number of drug-resistant mutations in HIV-1-A₂, a study conducted by Songok et al. [26] indicated that this subtype is rare in Kenya. Our study has also shown the presence of HIV-1 subtype B among the IDUs that had previously been reported to be predominantly found in the USA, Europe, Australia, Thailand, and Brazil [27, 28].

Moreover, earlier studies documented that HIV-1 subtypes are not randomly distributed among the globe and show distinct geographical distribution [29]. Subtypes A and D are the most dominant in Africa; subtype B in the USA, Europe, Australia, Thailand, and Brazil; subtype C in South Africa, Ethiopia, and India; F in some regions of Central Africa and Eastern Europe; and HIV-1-circulating recombinant form consisting of CRF01_AE in Southeast Asia [27]. The findings suggest a possible importation of rare subtypes, and this can be attributed to the commercial sex that is flourishing in the coastal region of Kenya. A study done in Kisumu, Kenya, reported that HIV-1 subtype was predominantly A (63%), followed by D (15%), C (3%), and G (1%) [30]. These results are in agreement with the findings from another study which reported A₁ (41/65, 63.1%), C (7/65, 10.8%), D (16/65, 24.6%), and G (1/65, 1.5%) [31]. However, contrary results were reported in Uganda which established HIV-1 seroconverts infected with subtype A (15%) and D (59%), suggesting predominance of subtype D [32]. In Brazil, among 69 IDUs’ samples amplified, 52 (75%) were identified as HIV-1 subtype B, 15 (22%) as subtype C, and 2 (3%) as subtype F (de Martínez et al. [32]). Kiwanuka et al. [33] reported that, globally, subtype C is the most successful of the HIV-1M lineages and accounts for >50% of infections, whereas subtypes A and B each account for over 10% of worldwide HIV infections. Subtypes D and G, CRF01_AE, and CRF02_AG account for only between 2% and 6% each. The difference in the proportions of HIV-1 subtypes suggests that it may be a driver of HIV-1-resistant mutation distribution in the population [34]. It is interesting that one HIV subtype can exhibit regional predominance. Perhaps, this subtype A has evolved to be more virulent than other strains due to improved replication fitness which may explain why it is more abundant.

Our study further shows that HIV-1 subtype A had significantly higher drug resistance followed by both C and D mutations. The finding is in agreement with other studies that reported having either HIV-1 subtype A or D is not associated with the acquisition of drug-resistant mutations [35]. However, M184V/I was significantly more common in subtype A as compared to subtype D. The absence of resistance mutation in subtype B is in contrast with other results [36] which established that the distributions of M184V/I were significantly associated with subtype B.

In the recent past, antiretroviral drugs were developed and efficacy tested with HIV-1 subtype B, and clinical effectiveness and pattern of drug resistance among subtype-B-infected individuals were established (Chaplin B. et al., 2011). Genetic differences between subtypes might impact the drug resistance pathways (Ode H. et al., 2007). It has been demonstrated that the mutational pathway to drug-resistant mutations to NRTI drugs may vary among different HIV-1 subtypes. However, the mechanisms and reason as to why this happens are yet to be fully assessed (Dumans A. T. et al., 2009). This could explain partly the absence of drug-resistant mutations in the HIV-1 B subtype in Kenya.

There was frequent occurrence of A62AV mutant genes in NRTIs followed by E138A mutation and A98G mutant genes in NNRTIs followed by K103N. These observations suggest that individuals on NRTIs are highly likely to develop A62AV and E138A, while those on NNRTIs are more likely to develop A98G and K103N mutant genes. Similarly, a study in Ghana among women with a history of prophylaxis recognized K103N and A98G as the dominant NNRTI mutations [36]. Furthermore, NNRTI mutations observed among drug-inexperienced individuals were K103N, V106A, and E138A with one minor drug resistance-associated mutation as A98G [36, 37]. Furthermore, HIV-1 subtype A exhibited most of mutant genes among drug-naïve participants affecting both NRTIs (K70KN, D67N, K70R, V75VI, M184LV, K219HQ, Y115YF, K65KE, and L74LW) and NNRTs (V106VI, V179IL, and G190AS). These findings show that NTRIs were the most resistant type of ART. However, studies in China revealed high percentages of NRTI (M184I/V) and NNRTI (K103N/S and Y181C/I) mutations in subtype B. High percentages of M184I/V (26.3%) and K103N/S (39.5%) were found in subtype B strains in ART-naïve individuals [38–40].

We have observed DRMs among the naïve and those using the drugs, and we have also observed more DRMs among those who have used ART for a long time. These suggest that the DRMs in ART-naïve IDUs could be due to acquisition of these mutations from patients failing treatment with resistant strains, prior exposure to ART, or undisclosed ART. This observation is in agreement with a recent study by Barik et al, (2021). Characterization of drug resistance mutations in RT gene of HIV-1 subtype C-infected individuals revealed that mutation M184V (63.15%) associated with lamivudine and abacavir and K103N (36.84%) identified in first-line ART failure in patients could be due to acquisition of these mutations from those failing treatment with resistant strains, prior exposures to ART, or undisclosed ART (41). This study is among the few that has investigated antiretroviral drug-resistant mutations and HIV-1 subtypes among hard-to-reach population of injecting drug users. However, snowball sampling approach used in this study is not representative and is prone to biases. Also, due to failure to consider the clinical parameters such as CD4⁺ cells and viral load, some samples failed to amplify. This is perhaps due to low copies of the virus that could not be detected by the nested RT-PCR. We however note that as much as the failure to amplify reduced the sample size, the findings are consistent with other studies.

5. Conclusion

All the HIV-1 subtypes have the drug-resistant mutations except subtype B. With drug-resistant mutations across all the HIV subtypes, there is a need to enhance the surveillance and more behavioral studies as IDUs may act as a source of drug resistance to the general population.

Data Availability

All data generated and analyzed are included within this research article.

Ethical Approval

Approval was obtained from the Scientific Ethical Review Unit (SERU)—Kenya Medical Research Institute (SSC no. 1438). The permission for the study was sought from Jaramogi Oginga Odinga University of Science and Technology (JOOUST). The procedures used in this study adhered to the standards of the Declaration of Helsinki.

Participation was solely voluntary upon consent. The research project obtained written informed consent from all participants after clearly introducing the purpose of the study and the right of the participant to refuse to participate or withdraw from the study at any time. No gifts or inducement was used to influence participation. Information regarding procedures of the study was provided to the participants including how the data were to be handled and used. The participants were taken through the informed consent document to ensure that they understood. Participation in this study presented no life-threatening risks. The authors affirm that participants provided informed consent for the publication regarding their individual data.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

Acknowledgments

The authors thank injecting drug users in Malindi who generously provided their time to participate in the study. They also acknowledge the role played by Kenya Medical Research Institute for allowing them to use their facilities for molecular analysis. They appreciate the efforts of all those personnel who made this work a success including the laboratory technicians.

References

D. Bure, M. Makhdoomi, R. Lodha et al., “Mutations in the reverse transcriptase and protease genes of human immunodeficiency virus-1 from antiretroviral naïve and treated pediatric patients,” Viruses, vol. 7, no. 2, pp. 590–603, 2015.
View at: Publisher Site | Google Scholar
H. Gatanaga, S. Ibe, M. Matsuda et al., “Drug-resistant HIV-1 prevalence in patients newly diagnosed with HIV/AIDS in Japan☆,” Antiviral Research, vol. 75, no. 1, pp. 75–82, 2007.
View at: Publisher Site | Google Scholar
J. W. Tang and D. Pillay, “Transmission of HIV-1 drug resistance,” Journal of Clinical Virology, vol. 30, no. 1, pp. 1–10, 2004.
View at: Publisher Site | Google Scholar
Z. Shubber, E. J. Mills, J. B. Nachega et al., “Patient-reported barriers to adherence to antiretroviral therapy: a systematic review and meta-analysis,” PLoS Medicine, vol. 13, no. 11, Article ID e1002183, 2016.
View at: Publisher Site | Google Scholar
D. R. Kuritzkes, C. M. Lalama, H. J. Ribaudo et al., “Preexisting resistance to nonnucleoside reverse‐transcriptase inhibitors predicts virologic failure of an efavirenz‐based regimen in treatment‐naive HIV‐1-Infected subjects,” Journal of Infectious Diseases, vol. 197, no. 6, pp. 867–870, 2008.
View at: Publisher Site | Google Scholar
A. Memarnejadian, S. Menbari, S. A. Mansouri et al., “Transmitted drug resistance mutations in antiretroviral-naïve injection drug users with chronic HIV-1 infection in Iran,” PLoS One, vol. 10, no. 5, Article ID e0126955, 2015.
View at: Publisher Site | Google Scholar
I. A. Nasir, A. U. Emeribe, I. Ojeamiren, and H. Aderinsayo Adekola, “Human immunodeficiency virus resistance testing technologies and their applicability in resource-limited settings of Africa,” Infectious diseases, vol. 10, 2017.
View at: Publisher Site | Google Scholar
M. S. Hirsch, H. F. Günthard, J. M. Schapiro et al., “Antiretroviral drug resistance testing in adult HIV‐1 infection: 2008 recommendations of an international AIDS society-USA panel,” Clinical Infectious Diseases, vol. 47, no. 2, pp. 266–285, 2008.
View at: Publisher Site | Google Scholar
M. C. Re, P. Monari, I. Bon, M. Borderi, F. Chiodo et al., “Conflicting interpretations of the prevalence of mutations associated with drug resistance in antiviral naı̈ve HIV-1 patients with acute and chronic infection,” International Journal of Antimicrobial Agents, vol. 23, no. 2, pp. 164–168, 2004.
View at: Publisher Site | Google Scholar
A. S. Hassan, H. M. Nabwera, S. M. Mwaringa et al., “HIV-1 virologic failure and acquired drug resistance among first-line antiretroviral experienced adults at a rural HIV clinic in coastal Kenya: a cross-sectional study,” AIDS Research and Therapy, vol. 11, pp. 9–12, 2014.
View at: Publisher Site | Google Scholar
S. Osman, R. W. Lihana, R. M. Kibaya et al., “Diversity of HIV type 1 and drug resistance mutations among injecting drug users in Kenya,” AIDS Research and Human Retroviruses, vol. 29, no. 1, pp. 187–190, 2013.
View at: Publisher Site | Google Scholar
R. W. Lihana, S. A. Khamadi, K. Lubano et al., “HIV type 1 subtype diversity and drug resistance among HIV type 1-infected Kenyan patients initiating antiretroviral therapy,” AIDS Research and Human Retroviruses, vol. 25, no. 12, pp. 1211–1217, 2009.
View at: Publisher Site | Google Scholar
Z. Wang, M. Zhang, R. Zhang et al., “Diversity of HIV-1 genotypes and high prevalence of pretreatment drug resistance in newly diagnosed HIV-infected patients in Shanghai, China,” BMC Infectious Diseases, vol. 19, pp. 313–319, 2019.
View at: Publisher Site | Google Scholar
R. Kantor, A. DeLong, M. Balamane et al., “HIV diversity and drug resistance from plasma and non-plasma analytes in a large treatment programme in western Kenya,” Journal of the International AIDS Society, vol. 17, no. 1, Article ID 19262, 2014.
View at: Publisher Site | Google Scholar
M. Ciccozzi, A. Lo Presti, A. Cenci et al., “May phylogenetic analysis support epidemiological investigation in identifying the source of HIV infection?” AIDS Research and Human Retroviruses, vol. 27, no. 5, pp. 455–457, 2011.
View at: Publisher Site | Google Scholar
W. Zhu, Y. Jiao, R. Lei et al., “Rapid turnover of 2-LTR HIV-1 DNA during early stage of highly active antiretroviral therapy,” PLoS One, vol. 6, no. 6, Article ID e21081, 2011.
View at: Publisher Site | Google Scholar
J. Currenti, A. Chopra, M. John et al., “Deep sequence analysis of HIV adaptation following vertical transmission reveals the impact of immune pressure on the evolution of HIV,” PLoS Pathogens, vol. 15, no. 12, Article ID e1008177, 2019.
View at: Publisher Site | Google Scholar
F. González-Candelas, J. Patiño-Galindo, and C. Valiente-Mullor, “Population genomics of human viruses,” in Population Genomics: Microorganisms, pp. 267–296, Springer, Cham, Switzerland, 2018.
View at: Google Scholar
J. D. Sousa, V. Müller, and A.-M. Vandamme, “The epidemic emergence of HIV: what novel enabling factors were involved?” Future Virology, vol. 12, no. 11, pp. 685–707, 2017.
View at: Publisher Site | Google Scholar
D. V. Dhar, P. Amit, and M. S. Kumar, “In-silico identification of new genes in HIV-1 by ORF prediction method,” International Research Journal of Biological Sciences, vol. 1, pp. 52–54, 2012.
View at: Google Scholar
R. W. Lihana, D. Ssemwanga, A. Abimiku, and N. Ndembi, “Update on HIV-1 diversity in Africa: a decade in review,” AIDS Reviews, vol. 14, pp. 83–100, 2012.
View at: Google Scholar
Mophs, National Guidelines for HIV Testing and Counselling in Kenya, Mophs, Nairobi, Kenya, 2010.
H. Mo, Guidelines for Antiretroviral Therapy in Kenya 2011, Ministry of Medical Services, Nairobi, Kenya, 2012.
P. O. Bessong, J. Mphahlele, I. A. Choge et al., “Resistance mutational analysis of HIV type 1 subtype C among rural South African drug-naive patients prior to large-scale availability of antiretrovirals,” AIDS Research and Human Retroviruses, vol. 22, no. 12, pp. 1306–1312, 2006.
View at: Publisher Site | Google Scholar
V. M. Macharia, C. Ngugi, R. Lihana, and M. O. Ngayo, “Transmitted HIV-1 drug resistance and the role of herpes simplex virus-2 coinfection among fishermen along the shores of Lake Victoria, Kisumu, Kenya,” Journal of HIV & Retro Virus, vol. 2, no. 3, 2016.
View at: Publisher Site | Google Scholar
E. M. Songok, R. W. Lihana, M. K. Kiptoo et al., “Identification ofenvCRF-10 among HIV variants circulating in rural western Kenya,” AIDS Research and Human Retroviruses, vol. 19, no. 2, pp. 161–165, 2003.
View at: Publisher Site | Google Scholar
A. J. Kandathil, S. Ramalingam, R. Kannangai, S. David, and G Sridharan, “Molecular epidemiology of HIV,” Indian Journal of Medical Research, vol. 121, pp. 333–344, 2005.
View at: Google Scholar
S. Kato, Y. Saito, R. Tanaka et al., “Differential prevalence of HIV type 1 subtype B and CRF01_AE among different sexual transmission groups in Tokyo, Japan, as revealed by subtype-specific PCR,” AIDS Research and Human Retroviruses, vol. 19, no. 11, pp. 1057–1063, 2003.
View at: Publisher Site | Google Scholar
C. Kuiken, R. Thakallapalli, A. Eskild, and A. de Ronde, “Genetic analysis reveals epidemiologic patterns in the spread of human immunodeficiency virus,” American Journal of Epidemiology, vol. 152, no. 9, pp. 814–822, 2000.
View at: Publisher Site | Google Scholar
N. Otecko, S. Inzaule, C. Odhiambo et al., “Viral and host characteristics of recent and established HIV-1 infections in Kisumu based on a multiassay approach,” Scientific Reports, vol. 6, pp. 37964–37969, 2016.
View at: Publisher Site | Google Scholar
Y. Shao and C. Williamson, “The HIV-1 epidemic: low- to middle-income countries,” Cold Spring Harbor perspectives in medicine, vol. 2, no. 3, Article ID a007187, 2012.
View at: Publisher Site | Google Scholar
A. M. B. de Martínez, E. F. Barbosa, P. C. P. Ferreira, F. A. Cardoso, and J. Silveira, “Molecular epidemiology of HIV-1 in rio grande, RS, Brazil,” Revista da Sociedade Brasileira de Medicina Tropical, vol. 35, pp. 471–476, 2002.
View at: Publisher Site | Google Scholar
N. Kiwanuka, O. Laeyendecker, M. Robb et al., “Effect of human immunodeficiency virus type 1 (HIV‐1) subtype on disease progression in persons from rakai, Uganda, with incident HIV‐1 infection,” Journal of Infectious Diseases, vol. 197, no. 5, pp. 707–713, 2008.
View at: Publisher Site | Google Scholar
M. J. Gartner, M. Roche, M. J. Churchill, P. R. Gorry, and J. K. Flynn, “Understanding the mechanisms driving the spread of subtype C HIV-1,” EBioMedicine, vol. 53, Article ID 102682, 2020.
View at: Publisher Site | Google Scholar
X. Lu, H. Zhao, Y. Zhang et al., “HIV-1 drug-resistant mutations and related risk factors among HIV-1-positive individuals experiencing treatment failure in Hebei Province, China,” AIDS Research and Therapy, vol. 14, pp. 4–13, 2017.
View at: Publisher Site | Google Scholar
B. Chaplin, G. Eisen, J. Idoko et al., “Impact of HIV type 1 subtype on drug resistance mutations in Nigerian patients failing first-line therapy,” AIDS Research and Human Retroviruses, vol. 27, no. 1, pp. 71–80, 2011.
View at: Publisher Site | Google Scholar
A. Martin-Odoom, C. A. Brown, J. K. Odoom, E. Y. Bonney, and N. A. A. Ntim, “Emergence of HIV-1 drug resistance mutations in mothers on treatment with a history of prophylaxis in Ghana,” Virology Journal, vol. 15, pp. 1–9, 2018.
View at: Publisher Site | Google Scholar
A. Martin-Odoom, T. Adiku, E. Delgado, M. Lartey, and W. K. Ampofo, “Occurrence of transmitted HIV-1 drug resistance among Drug-naïve pregnant women in selected HIV-care centres in Ghana,” Ghana Medical Journal, vol. 51, no. 1, pp. 20–23, 2017.
View at: Publisher Site | Google Scholar
L. Zuo, K. Liu, H. Liu et al., “Trend of HIV-1 drug resistance in China: a systematic review and meta-analysis of data accumulated over 17 years (2001-2017),” EClinicalMedicine, vol. 18, Article ID 100238, 2020.
View at: Publisher Site | Google Scholar
H. Onywera, D. Maman, S. Inzaule et al., “Surveillance of HIV-1 pol transmitted drug resistance in acutely and recently infected antiretroviral drug-naïve persons in rural western Kenya,” PLoS One, vol. 12, no. 2, Article ID e0171124, 2017.
View at: Publisher Site | Google Scholar

Copyright

Copyright © 2022 Gabriel O. Ng’ong’a et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PDF Download Citation

Download other formats

Order printed copies

Views

746

Downloads

799

Citations